1996(Apr-Jun)

top > 1996(Apr-Jun)



1996 Apr-Jun
Apr
01 02 03 04 05 06 07 08 09
10 11 12 13 14 15 16 17 18 19
20 21 22 23 24 25 26 27 28 29
30
May
01 02 03 04 05 06 07 08 09
10 11 12 13 14 15 16 17 18 19
20 21 22 23 24 25 26 27 28 29
30 31
Jun
01 02 03 04 05 06 07 08 09
10 11 12 13 14 15 16 17 18 19
20 21 22 23 24 25 26 27 28 29
30

Information from web.

AllPolitics - Political Aptitude ...
AllPolitics home page. Copyright © 1997 AllPolitics All Rights Reserved. Terms under which this information is provided to you ...

BosNet NEWS / Apr 10, 1996
BosNet NEWS / Apr 10, 1996. From: Davor <dwagner@MAILBOX.SYR.EDU> Bosnia-Herzegovina News Directory. Source ONASA: ...

Poster
Endangered Missing. LOGAN TUCKER. DOB: Apr 10, 1996. Missing: Jun 23, 2002. Age Now: 14. Sex: Male. Race: White. Hair: Blonde ...

CNN - Ron Brown Burial - Apr. 10, 1996
Copyright © 1996 Cable News Network, Inc. ALL RIGHTS RESERVED. External sites are not endorsed by CNN Interactive. ...

YouTube - Vial vs Ray Apr 10, 1996
hockeyfightsdotcom — February 09, 2007 — Dennis Vial vs Rob Ray from the Senators at Sabres game on Apr 10, 1996. ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Apr 10, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

News Releases - Government of ...
Apr. 10, 1996 - UPSHALL DISCUSSES TRADE IN MEAT AND OILSEED ... Apr. 10, 1996 - PRUNING RESTRICTIONS FOR ELM TREES IN EFFECT ...

00ls-lRfile
... Oct 29 1995 development/ drwxrwxr-x 6 koziol 2048 Feb 26 1998 game/ drwxrwxr-x 8 koziol 2048 Apr 18 1996 graphics ...

outlookindia.com - Contents - April ...
Contents | MAGAZINE | Apr 10, 1996 ... Apr 10, 1996. Regulars. Delhi Diary ... The page 3 people, the chatterati and those in ...

Province of Nova Scotia – Hansard 56-4
Wed., Apr. 10, 1996. 389. 456. 96–07. Tue., Apr. 9, 1996. 323. 388. 96–06. Thur., Apr. 4, 1996. 265. 322. 96–05. Wed., Apr. 3, ...

IDRA: Historical Prices for Idera ...
Apr 10, 1996. 6.87. 7.38. 6.87. 7.25. 2,100. 290.00. Apr 9, 1996. 8.25. 8.25. 5.13. 7.00. 9,000. 280.00. Apr 8, 1996. 8.25 ...

JMS on CompuServe (Apr 10, 1996 PM ...
JMS on CompuServe (Apr 10, 1996 PM) *POSSIBLE SPOILERS* 3/3. Brent Barrett brent.barrett at 24stex.com ...

Theatre of Dreams FTP Application
30867 Apr 10 1996 beckham.gif ... 15049 Apr 10 1996 buttcity.gif ... 7432 Apr 10 1996 cantona.jpg. 16523 Aug 12 1996 ...

Missouri Secretary of State Robin ...
Executive Order 7 - Kansas and Missouri Culture District Compact (Apr. 10, 1996) Executive Order 8 - Renewal of ...

World-Wide Web Access Statistics for ...
... 1642 | Apr 10 1996 4.94 2.47 2692818 1049 | Apr 11 1996 6.41 7.23 7872338 1361 | Apr 12 1996 0.48 0.30 323715 102 ...

CNN - U.S. News Briefs - Apr. 11, 1996
TRENTON, New Jersey (CNN) -- The state of New Jersey has decided to become the latest state to sue the tobacco industry ...

AllPolitics - Alma Was Alarmed - Apr ...
NEW YORK (AllPolitics, April 11) -- Both the hate mail and random callers were scary during the time her husband ...

Apr 11, 1996 Domi x Probert.wmv
Apr 11, 1996 Domi x Probert.wmv (3.8 MB) remove ads - Password Protected File - Please enter the password below ...

News Releases - Government of ...
Apr. 11, 1996 - UPSHALL ATTENDS INTERNATIONAL FOOD SHOW IN SOUTH KOREA. Apr. 10, 1996 - UPSHALL DISCUSSES TRADE IN ...

CS267: Notes for Lecture 24, Apr 11 1996
CS267: Lecture 24, Apr 11 1996. Fast Hierarchical Methods for the N-body Problem, Part 1. Table of Contents. Motivation ...

Chicago Reader | Issue Archives ...
Comprehensive guide to Chicago ... Tags: Music Sidebar, Hitsville, Lounge Ax. Soul Survivor. Snooks Eaglin: The Complete ...

IDRA: Historical Prices for Idera ...
Apr 11, 1996. 8.00. 8.00. 7.62. 7.75. 700. 310.00. Apr 10, 1996. 6.87. 7.38. 6.87. 7.25. 2,100. 290.00. Apr 9, 1996. 8.25. 8.25 ...

YouTube - Daneyko vs Kaminski Apr 11 ...
Ken Daneyko vs Kevin Kaminski from the Devils at Capitals game on Apr 11, 1996.<br />via http://www.hockeyfights.com

World-Wide Web Access Statistics for ...
... 4.42 3.53 31494518 6673 | Apr 10 1996 3.68 3.68 32840628 5561 | Apr 11 1996 3.70 3.85 34412804 5597 | Apr 12 1996 ...

Hansard -- Thur., Apr. 11, 1996
I will call the House to order at this time. Are there any introductions of guests before we begin? If not, the ...

The Makers by Howard Nemerov | The ...
Thursday. Apr. 11, 1996 "Prev. Next" E-mail. Share. Digg. del.icio.us. Facebook. The Makers. by Howard Nemerov. THURSDAY 4/11 ...

DePauw University vs Anderson ...
DePauw Softball DePauw University at Anderson University Apr 11, 1996 at Anderson, Indiana DePauw University 8 ...

Re: Intelligent Debugging Tools ...
36 messages in org.freebsd.freebsd-hackersRe: Intelligent Debugging Tools... From. Sent On. Attachments. Marc G. Fournier ...

World-Wide Web Access Statistics for ...
... 1642 | Apr 10 1996 4.94 2.47 2692818 1049 | Apr 11 1996 6.41 7.23 7872338 1361 | Apr 12 1996 0.48 0.30 323715 102 ...

DePauw University Softball
DePauw University 8, Anderson University 5 (Apr 11, 1996 at Anderson, Indiana) ... (Apr 11, 1996 at Anderson, Indiana) ...

CNN - Jessica Dubroff: 1988-1996 ...
Copyright © 1996 Cable News Network, Inc. ALL RIGHTS RESERVED. External sites are not endorsed by CNN Interactive. ...

info-cvs : Messages : 1025-1054 of 26776
info-cvs: installing and using CVS ... Message search is now enhanced, find messages faster. Take it for a spin. Best of Y! Groups ...

APR 12 1996
06/11/99. SW195.412. 96-04-12.doc. APR 12 1996. Ms. Joan M. Korpal. Manager of Regulatory Compliance. Shell Oil Products Company ...

Picasa Web Albums - Himanshu
24 albums ... Some features may not work too well, but you are welcome to have a look around. Explore. Himanshu's Gallery ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Apr 12, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

AllPolitics - Gramm's Edge - Apr. 12 ...
is stressing his experience, but also is talking about his beginnings as a teacher, apparently hoping some of Morales' ...

Issue #322 | Magazine Archive | More ...
by Benjamin Svetkey | Apr 12, 1996 ... by Frank Lovece | Apr 12, 1996 ... Apr 12, 1996. Check out letters from those ...

Weekly Checklist 96-15 (Apr. 12, 1996)
Search the DSP Web site for. Weekly Checklist 96-15 (Apr. 12, 1996) [ How to Order Publications ] For use by persons ...

Toronto, ON - Apr 28, 1996 - Concert ...
Tracks (Click song title for lyrics) Crash On The Levee (Down In The Flood) Tonight I'll Be Staying Here With You ...

Reissue Applications Notice - OG ...
S.N. 08/631,222, Apr. 12, 1996, Cl. 381/36, PROCESSING OF ACOUSTIC ... S.N. 08/631,082, Apr. 12, 1996, Cl. 206/278, ...

Sask Gazette, Part I, Apr 12, 1996
EXTRAITS DES RÈGLES ET PROCÉDURES DE. L'ASSEMBLÉE LÉGISLATIVE DE LA. SASKATCHEWAN AU SUJET DES. PROJETS DE LOI D'INTERÊT ...

AllPolitics - The Matty Flap - Apr ...
Was Matalin A Wise Choice For Dole Campaign? WASHINGTON (AllPolitics, April 12) -- Some GOP officials are dismayed ...

News - Articles - 1427523 - 19960412
Apr 12 1996 12:00 AM EDT. Soundgarden Returns. Views151. April 12, 1996 -- In other music news, more than two years ...

Getting under the surface
Publication Date: Friday Apr 12, 1996. Getting under the surface. Smith Andersen Gallery presents recent work by ...

Gerald Oskoboiny: 1996
Web site mentioned in Wired magazine (for my winning list of guestbooks contest entry) Feb ~26 - Apr ~12, 1996. Contract ...

CNN - World Fringe - Apr. 13, 1996
NEW YORK (CNN) -- Imagine a chocolate Easter icon with a body like a rat, feet like a chicken and ears like a rabbit. ...

WORLD Magazine | Today's News ...
World Magazine is a full color biweekly news magazine that provides complete coverage of national news and international news, ...

Hyakutake2
Comet Hyakutake Apr. 13,1996

Madison, NJ - Apr 13, 1996 - Simon ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Apr 13, 1996. Madison, NJ. Simon Forum Athletic Center. Average: 0. what is this? ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Apr 13, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

Search Results (v2)
... Sea /. 1st ed., Apr. 13, 1996 (Correct through NM ... Steno Kasou /. 3rd ed., Apr. 13, 1996 (Correct through NM 15/96) ...

WORLD Magazine | Doubting Darwin ...
Renewables like solar power and others can't fuel America's future. FULL STORY. Table of Contents View E-zine Archives ...

The official Dilbert website with ...
The Official Dilbert Website featuring Scott Adams Dilbert strips, animation, mashups and more starring Dilbert, Dogbert, Wally, ...

Hanover College vs DePauw University ...
... Tournament Hanover College at DePauw University Apr 13, 1996 at ... Apr 13, 1996 at Greencastle, Indiana Score by Innings R H ...

CNN - New on the Net - Apr. 13, 1996
The 80th annual Pulitzer Prizes for journalism, letters, drama and music were announced this week. To learn about ...

World-Wide Web Access Statistics for ...
... 10 1996 4.94 2.47 2692818 1049 | Apr 11 1996 6.41 7.23 7872338 1361 | Apr 12 1996 0.48 0.30 323715 102 | Apr 13 1996 ...

CCN Dialup Usage for Week Ending Apr ...
... 30 ++ * * ++ 20 ++ * * ++ |10 ++ ** + + +0 ++-*0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Content on this page requires a ...
3. Giovanni Parisi. Sept 25, 1992. 4. Oscar de la Hoya. July 29, 1994. 5. Artur Grigorian. Apr 13, 1996. 6. Acelino Freitas ...

Daily Transmission Statistics
... Apr 13 1996 2.87 4.40 1,573,531,704 127,811 | Apr 14 1996 3.47 3.97 1,417,585,908 154,191 | Apr 15 1996 3.00 2.61 ...

Eyeglass - Google Patent Search
Filing date: May 23, 2001. Issue date: Apr 30, 2002. Application number: 29/142,308. Inventors: James H. Jannard, ...

PUBLIC LAW 104–134—APR. 26, 1996 110 ...
Of the funds made available for installment acquisition pay. ments under this heading in Public Law 104–52, $3,400,000 are ...

NHL Fights from Apr 14, 1996 ...
... events from Apr 14, 1996 Winnipeg ... online marketing. Apr 14, 1996. Winnipeg - Anaheim. 2-5. Summary Of Events. 1 ...

New Haven, CT - Apr 14, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Apr 14, 1996. New Haven, CT. Palace Theater. Average: 0. what is this? Tracks ...

M13
Hercules cluster M13. Picture taken Apr. 14,1996, exposure 15s.

U.S. Petroleum Data - Statistics ...
In millions of barrels except refinery utilization Apr 12 Apr 5 Apr 14 1996 1996 1995 Gasoline production, daily 7.5...

AllPolitics - Doles Release Tax Info ...
Politics Prove Taxing In Election Year -- Apr. 14, 1996. Clintons Pay $75,000 In Federal Taxes -- Apr. 12, 1996 ...

Building Permits for Friday Apr 19, 1996
18 Fairbanks Lane, Signature Roofing, re-roofing: res., $ 16,200; guest house, $6,400; garage, $2,100. 750 El Camino ...

World-Wide Web Access Statistics for ...
... 1996 0.38 0.44 479524 80 | Apr 14 1996 2.16 1.81 1973921 458 | Apr 15 1996 2.86 2.65 2883996 608 | Apr 16 1996 8.85 ...

nancies.org: tour: reviews: apr.14.1996
home | about | news | music | tour. apr.14.1996. Dave Matthews & Tim Reynolds. Sweetbriar College, Sweetbriar, Virginia. Apr. ...

Picasa Web Albums - Lin
96 albums ... Some features may not work too well, but you are welcome to have a look around. Explore. Lin's Gallery. Problems? ...

ANTITERRORISM AND EFFECTIVE DEATH ...
To deter terrorism, provide justice for victims, provide for an effective death penalty, and for other purposes. ...

M57
Planetary nebula M57, Image taken Apr. 14,1996

xfer_960418.html
TOTALS FOR SUMMARY PERIOD Wed Apr 17 1996 TO Thu Apr 18 1996. Files Transmitted During Summary Period 14922 Bytes ...

ZANE: Basic Chart for Zanett Inc ...
Access the chart for Zanett Inc. (ZANE) in line, bar or candlestick type. Customize the date range from 1 day, 5-day, ...

xfer_960415.html
TOTALS FOR SUMMARY PERIOD Sun Apr 14 1996 TO Mon Apr 15 1996 ... Sun Apr 14 1996 14489 3361717468 5.2 KB/s 98.49 98.57 Mon ...

Letters, Apr. 15, 1996 - TIME
Letters, Apr. 15, 1996. Monday, Apr. 15, 1996 ... The genuine suffering of the victims makes me resent all the more the ...

People, Apr. 15, 1996 - TIME
SEEN & HEARD If the book hasn't transported you to paradise, the sound track to ... By Belinda Luscombe Monday, Apr. 15, 1996 ...

News Releases - Government of ...
Apr. 15, 1996 - PREMIER ANNOUNCES INNOVATION PLACE EXPANSION. Apr. 15, 1996 ... Apr. 15, 1996 - SASKTEL TABLES 1995 ANNUAL REPORT ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Apr 15, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

High Country News
by Richard Hicks, Apr 15, 1996 ... by Elizabeth Manning, Apr 15, 1996 ... by Ed Marston, Apr 15, 1996. Experts line ...

EWJ: Historical Prices for iShares ...
Apr 15, 1996. 15.69. 15.75. 15.69. 15.75. 525,000. 13.65. Apr 12, 1996. 15.63. 15.69. 15.63. 15.69. 1,800. 13.60. Apr 11, 1996 ...

Apr 1996
-SFRT II RoundTable Category 18, Topic 1 Message 238 Mon Apr 15, 1996 STRACZYNSKI [Joe] at 05:56 EDT WB will *never ...

He Will Not Be Broken : Apr 15, 1996 ...
... years, 1,916 covers and 49,834 stories from PEOPLE magazine's history for you to enjoy. Apr 15, 1996 Vol. 45 No. 15 ...

Oct 15, 1996 to Apr 15, 1997 Density ...
Apr 15, 1996 to Oct 15, 1996 Density s Southern Hem. ... Apr 15, 1996 to Apr 15, 1997 Density s Southern Hem. ...

Collegiate Update Vol. 1, no.27
GYMN-L Collegiate Update. Volume 1, no. 27. Apr. 15, 1996. East Region Qualifiers (M) All-Around East Regionals (M) Indiv. ...

The New Yorker Digital Edition : Apr ...
The New Yorker : Apr 15, 1996. Contents. Comment. Cartoon. Easel. The Current Cinema. The Talk of the Town. The Talk of the Town ...

AllPolitics - Symbolic Tax Vote ...
House Considers Two-Thirds Majority For Tax Measures. WASHINGTON (AllPolitics, April 15) -- In a largely symbolic ...

AllPolitics - Engler Under Scrutiny ...
As A Possible VP Choice, Engler Gets More Attention. LANSING, Mich. (AllPolitics, April 15) -- Now that he's being ...

Absence by May Sarton | The Writer's ...
Apr. 15, 1996 "Prev. Next" E-mail. Share. Digg. del.icio.us. Facebook. Absence. by May Sarton. MONDAY 4/15. Today's ...

April 15, 1996 Cleveland Indians at ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Apr 15, 1996, Indians at Red Sox Box Score and Play by Play ...

Letters, Apr. 15, 1996 - TIME
YOUR COVERAGE OF THE TRAGEDY AT Dunblane was a sensitive and moving tribute to the grieving parents and friends of the dead. ...

GovTrack: House Vote #119 (Apr 16, 1996)
Suspend the rules and pass, as amended: H R 2337 Taxpayer Bill of Rights Act ... Apr 16, 1996 3:04PM. Result: Passed. Related Bill: ...

News Releases - Government of ...
Apr. 16, 1996 - NEW HEALING ... Apr. 16, 1996 - AMENDMENTS TO MUNICIPAL LEGISLATION INTRODUCED. Apr. 16, 1996 - DEADLINE FOR CROP ...

CNN - Hubble reveals 'tadpoles' in ...
WASHINGTON (CNN) -- There are tadpole-shaped pods 100 billion miles long floating in space, photographs taken by ...

CS267: Notes for Lecture 25, Apr 16 1996
CS267: Lecture 25, Apr 16 1996. Fast Hierarchical Methods for the N-body Problem, Part 2. Table of Contents. The ...

Springfield, MA - Apr 16, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Apr 16, 1996. Springfield, MA. Symphony Hall. Average: 0. what is this? Tracks ...

BosNet NEWS / Apr. 16, 1996
BosNet NEWS / Apr. 16, 1996. From: Nermin Zukic <n6zukic@SMS.BUSINESS.UWO.CA> Bosnia-Herzegovina News Directory. CONTENTS ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Apr 16, 1996. In the interest of speed transcripts of IFOR press briefings are issued in unedited format ...

St. Mary/Woods vs DePauw University ...
... Mary/Woods at DePauw University Apr 16, 1996 at Greencastle, Indiana St. ... DePauw University - Play-by-Play Apr 16, 1996 ...

OMRI: PURSUING BALKAN PEACE, V1,#15 ...
OMRI: PURSUING BALKAN PEACE, V1,#15, Apr. 16, 1996. From: OMRI-L <omri-l@ubvm.cc.buffalo.edu> Open Media Research ...

St. Mary/Woods vs DePauw University ...
DePauw Softball St. Mary/Woods at DePauw University Apr 16, 1996 at Greencastle, ... University - Play-by-Play Apr 16, 1996 ...

AllPolitics - Veep Possibilities ...
secured enough delegates for the GOP presidential nomination, he became the keeper of the hottest list around -- the ...

Hansard -- Tue., Apr. 16, 1996
I will call the House to order at this time to commence the daily agenda. We usually open with the introduction ...

AllPolitics - Tax Measure Fails ...
... to make it harder for Congress to raise taxes was easily defeated in the House of Representatives Monday night. ...

EWJ: Historical Prices for iShares ...
Apr 16, 1996. 15.69. 15.81. 15.69. 15.75. 243,600. 13.65. Apr 15, 1996. 15.69. 15.75. 15.69. 15.75. 525,000. 13.65. Apr 12, ...

Milestones Apr. 22, 1996 - TIME
... Representative; as Commerce Secretary; Charlene Barshefsky, 45, Kantor's deputy, was named acting Trade Representative. ...

Milestones Apr. 1, 1996 - TIME
Deliberations were deadlocked, and a mistrial was declared. This time, a single jury accepted the prosecution's ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Apr 17, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

Silverwood Lake Recreation - News ...
Silverwood Lake Recreation - News Release, Apr. 17, 1996. California Department of Water Resources NEWS ...

AllPolitics - Political Aptitude ...
This week's Political Aptitude Test question asks, which of the following presidents won among voters of one gender ...

Meetings & Performances (r)
Meetings & Performances (r) From: apakabar@clark.net. Date: Wed Apr 17 1996 - 15:55:00 EDT. From: John MacDougall <apakabar ...

AllPolitics - The Stealth Candidate ...
... official Ann Lewis said her candidate may not even make the much-expected, much-ballyhooed traditional announcement. ...

Burlington, VT - Apr 17, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Apr 17, 1996. Burlington, VT. Patrick Gymnasium. Average: 1. Average: 1 (1 vote) what is ...

GovTrack: Senate Vote #69 (Apr 17, 1996)
On the Motion to Table the Motion to Recommit (MOTION TO TABLE THE MOTION TO ... Apr 17, 1996 5:50PM. Result: Motion to ...

Dee Dee Davis > Overview - AllMovie
Apr 17, 1996 - Culver City, CA. Years Active. 1910. 20. 30. 40. 50. 60. 70. 80. 90. 2000. Countries. USA. Genres. Comedy. Types ...

Still Cool Archive - Cool Site of ...
Apr 17, 1996: Nash Bridges. Apr 18, 1996: Exploding Mac. Apr 19, 1996: Cocktail. Apr 20, 1996: The Royal Network. Apr 21, 1996: ...

outlookindia.com - Contents - April ...
Contents | MAGAZINE | Apr 17, 1996 ... Apr 17, 1996. Regulars. Bombay Diary ... The page 3 people, the chatterati and those ...

ISOFT - Home of Japanese Software
Apr.17,1996(Wed) I current have 3 things to do: re-upload files that were deleted, update manga page to show new ...

Softball squads face hard work
Publication Date: Wednesday Apr 17, 1996. Softball squads face hard work ... This is the most critical week of the season ...

[TXT] es4-17-96.html
VATICAN CITY, APR 17, 1996 (VIS) - From apostolic times the popes have preserved all written documents pertinent ...

Letters, Apr. 15, 1996 - TIME
YOUR COVERAGE OF THE TRAGEDY AT Dunblane was a sensitive and moving tribute to the grieving parents and friends of the dead. ...

News Releases - Government of ...
Apr. 18, 1996 - LA LOCHE ROAD TRAINING AGREEMENT REACHED ... Apr. 18, 1996 - 1995 STC ANNUAL REPORT TABLED ...

AllPolitics - Another Choice, Please ...
... voters would like to see a third-party candidate in this fall's presidential election, according to a new poll. ...

Chicago Reader | Issue Archives ...
Comprehensive guide to Chicago ... Google the site Search our articles archive Search for an event " Previous Issue. Next ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Apr 18, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

AllPolitics - Call For A Cease-Fire ...
... base and said he has directed Secretary of State Warren Christopher to go to the region to try to broker a peace. ...

Hansard -- Thur., Apr. 18, 1996
... members in the Legislature, the presence in the west gallery of the Warden of the Municipality of the County of ...

Archive - Apr 18, 1996 | Wawatay Online
Archive - Apr 18, 1996. Date. All. 1976. 1977. 1978. 1979. 1980. 1982. 1983. 1984. 1985. 1986. 1987. 1988. 1989. 1990. 1991 ...

Consolation by Billy Collins | The ...
Apr. 18, 1996 "Prev. Next" E-mail. Share. Digg. del.icio.us. Facebook. Consolation. by Billy Collins. THURSDAY 4/18 ...

The official Dilbert website with ...
Apr 18, 1996. 42 Votes. 1 Comments. 4.23. Apr 12, 1996. 41 Votes. 9 Comments. 4.11. Apr 8, 1996. 34 Votes. 6 Comments. 4.18 ...

Providence, RI - Apr 18, 1996 - The ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Apr 18, 1996. Providence, RI. The Strand. Average: 0. what is this? Tracks ...

ISOFT - Home of Japanese Software
Apr.18,1996(Thu) First, some one sent some bad mail and it hangs up the pop3 server. I'm not able to get around ...

World-Wide Web Access Statistics for ...
... 1879 | Apr 17 1996 4.45 3.22 3509233 944 | Apr 18 1996 6.37 9.56 10413610 1352 | Apr 19 1996 1.38 0.70 759653 292 ...

00ls-lRfile
... drwxrwxr-x 6 koziol 2048 Feb 26 1998 game/ drwxrwxr-x 8 koziol 2048 Apr 18 1996 graphics/ drwxrwxr-x 10 koziol ...

Daily Transmission Statistics
... Apr 16 1996 2.99 2.69 963,266,937 133,012 | Apr 17 1996 3.22 2.80 999,980,882 142,976 | Apr 18 1996 3.14 2.81 1, ...

Poster
Logan's photo is shown age-progressed to 9 years. He was last seen at home on June 23, 2002 and is missing under ...

Letters, Apr. 8, 1996 - TIME
THE TRUTH ABOUT WHITEWATER ... It reveals an extremely disturbing pattern of deceit, dishonesty and use of power for personal ...

* Public Law 104–134 104th Congress ...
Note: This is a typeset print of the original hand enrollment as signed by the President on. April 26, 1996. The ...

Contributors: Apr. 8, 1996 - TIME
... reporting on people's faith, having kept TIME readers abreast of developments in religion for more than two decades. ...

ISOFT - Home of Japanese Software
Apr.19,1996(Fri) If you haven't gone to the Books section recently, please go there today. I've added some more books while I ...

Search Results (v2)
WAIS Search Results. Results for query: (itemno="0378-E- 25") Mediterranean Sea, Italy--Croatia--Bosnia and Herzegovina ...

Indian Ocean Report 4/96
... 120 27.4 1.5 21837 1326 -28.47 -85.53 91 120 22.1 1.4 21838 1326 -28.82 -78.76 90 120 21.7 0.7 21843 1326 13.70 ...

News Releases - Government of ...
Apr. 19, 1996 - UPSHALL PURSUES TRADE OPPORTUNITIES IN HONG KONG. Apr. 18, 1996 - LA LOCHE ROAD TRAINING AGREEMENT REACHED ...

CNN - Caught in the crossfire - Apr ...
Copyright © 1996 Cable News Network, Inc. ALL RIGHTS RESERVED. External sites are not endorsed by CNN Interactive. ...

Health care world >> PMS catalogue
street price ca 100 k$, very high added clinical value; sales limited to specialist areas "PACS" workstations. Teleradiology ...

Building Permits for Friday Apr 19, 1996
Building Permits. Publication Date: Friday Apr 19, 1996. Atherton. 35 Isabella Ave., Precision Pipeline, encroachment ...

Carolyn's Diary
The office is closed today - we decided to take a long long weekend after all the fuss and performance in acquiring ...

Portland, ME - Apr 19, 1996 - State ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Apr 19, 1996. Portland, ME. State Theater. Average: 0. what is this? Tracks ...

IN: Ganesa Dibredel
IN: Ganesa Dibredel. From: apakabar@clark.net. Date: Fri Apr 19 1996 - 12:38:00 EDT. From: John MacDougall <apakabar@clark.net> ...

Theatre of Dreams FTP Application
65540 Jul 19 1997 10score.jpg. 7629 Mar 16 21:22 140398.gif. 15592 Nov 25 1996 16midd.jpg. 1041 Mar 16 0:06 2.GIF ...

BosNet NEWS / Apr. 20, 1996
BosNet NEWS / Apr. 20, 1996. From: Nermin Zukic <n6zukic@SMS.BUSINESS.UWO.CA> Bosnia-Herzegovina News Directory. CONTENTS ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Apr 20, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

Portland, ME - Apr 20, 1996 - State ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Apr 20, 1996. Portland, ME. State Theater. Average: 0. what is this? Tracks ...

WORLD Magazine | Today's News ...
Apr. 20, 1996. Children of Chernobyl. Apr. 13, 1996. Tinkering with the tax code. Apr. 6, 1996. Bosnian relief. Mar. 30, 1996 ...

ISOFT - Home of Japanese Software
Apr.20,1996(Sat) Some new manga came in. Check the Manga section. Apr.19,1996(Fri) If you haven't gone to the Books ...

WORLD Magazine | Quotables | | Apr ...
WORLD's 2010 Book of the Year: Arthur Brooks' The Battle. FULL STORY. Table of Contents View E-zine Archives Classifieds ...

Manchester College vs DePauw ...
Mid-America Baseball Tournament Manchester College at DePauw University Apr 20, 1996 at Greencastle, ...

Marian cults - The Irish Times - Sat ...
BACKING into a little sidestreet in Kilbarrack, the white, double decker wedding bud signalled that the big commitment had almost ...

World-Wide Web Access Statistics for ...
... 17 1996 4.45 3.22 3509233 944 | Apr 18 1996 6.37 9.56 10413610 1352 | Apr 19 1996 1.38 0.70 759653 292 | Apr 20 1996 ...

txt
... 15 : Week Ending : -1992- These 14 States produced 99% of the State:Apr 20,:Apr 13,:Apr 20,: 1996 1996 cotton crop. ...

LUCKY KENTUCKY - The Irish Times ...
I KNEW I was flying into, horse country when, as the overhead sign was switched got off the little man beside men from the ...

LaGrange College vs Georgia ...
... vs Georgia Southwestern (Apr 20, 1996) ... Baseball 2004 LaGrange College at Georgia Southwestern Apr 20, 1996 at Americus, ...

CNN - Severe weather lashes Midwest ...
KANSAS CITY, Missouri (CNN) -- An outbreak of tornadoes and baseball-sized hail spread damage across a large section ...

Search Results (v2)
Asia, China--east coast, Yong Jiang and approaches /. 6th ed., Apr. 20, 1996 (Correct through NM 16/96) ...

The Lancet : Volume 347, Apr 20, 1996
The Lancet is the world's leading general medical journal and specialty journals in Oncology, Neurology and Infectious Diseases. ...

TWU - TWU Libraries - 1996 TWU Update
Texas Woman's University, with campuses in Denton, Dallas, and Houston, Texas, ... Apr 19-Apr 21, 1996. Apr 15-Apr 21, 1996 ...

Portland, ME - Apr 21, 1996 - State ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Apr 21, 1996. Portland, ME. State Theater. Average: 0. what is this? Tracks ...

Issues: Law & Liberty (r)
Issues: Law & Liberty (r) From: apakabar@clark.net. Date: Sun Apr 21 1996 - 16:02:00 EDT. From: John MacDougall <apakabar@clark.net> ...

Arts & Culture Corner (r)
Arts & Culture Corner (r) From: apakabar@clark.net. Date: Sun Apr 21 1996 - 16:00:00 EDT. From: John MacDougall <apakabar@clark.net> ...

Georgia Southwestern vs LaGrange ...
... vs LaGrange College (Apr 21, 1996) ... Baseball 2004 Georgia Southwestern at LaGrange College Apr 21, 1996 at LaGrange, ...

Gridface: April 1996
Home. Archives. Forums. Links. About. Contact. April 1996. Björk: "Hyper-ballad" Apr 21, 1996 in Reviews: Electronica ...

Daily Transmission Statistics
... 664 139,490 | Apr 19 1996 2.25 2.11 754,216,383 99,926 | Apr 20 1996 2.33 2.12 757,574,852 103,543 | Apr 21 1996 ...

CCN Dialup Usage for Week Ending Apr ...
... 40 ++ * * ++ |30 ++ * * ++ 20 ++ * ** ++ 10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

BGreek: By Subject
Marcel CoumontBeisig (Sun Apr 21 1996 - 23:19:36 EDT) ... Kenneth Litwak (Sun Apr 21 1996 - 19:30:04 EDT) ...

Tridents vs ImageBuildersRobur58 ...
... vs ImageBuildersRobur58 (Apr 21, 1996) ... The Automated ScoreBook Tridents at ImageBuildersRobur58 Apr 21, 1996 at Apeldoorn ...

April 21, 1996 Baltimore Orioles at ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Apr 21, 1996, Orioles at Rangers Box Score and Play by Play ...

April 21, 1996 Detroit Tigers at ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Apr 21, 1996, Tigers at Angels Box Score and Play by Play ...

World-Wide Web Access Statistics for ...
... Apr 20 1996 2.46 2.46 15406463 2870 | Apr 21 1996 3.88 4.40 27580683 4525 | Apr 22 1996 3.82 4.35 27297908 4454 ...

Picasa Web Albums - feeroj
Apr 21, 1996. Photos: 683. Marriage 6Dec 1992. Dec 6, 1992. Photos: 151. Pitthi 5Dec 1992. Dec 5, 1992. Photos: 46. Engagement ...

Luigi Pistilli
Luigi Pistilli. Born Jul. 19 1929, Grosseto, Italy - Died Apr. 21 1996, Milan, Italy (suicide) Spaghetti Western filmography: ...

TIME Magazine Cover: Jessica Dubroff ...
Jessica Dubroff. Apr. 22, 1996. E-mail this. previous week's cover | following week's cover. LACY ATKINS - AP. Buy This Cover ...

Letters, Apr. 22, 1996 - TIME
Letters, Apr. 22, 1996. Monday, Apr. 22, 1996 ... As a programmer, I agree that computers can mimic the human thinking process ...

News Releases - Government of ...
Apr. 22, 1996 - RECORD SEEDED AREA EXPECTED IN 1996. Apr. 22, 1996 ... Apr. 22, 1996 - NIPAWIN TO HOST 1998 SASKATCHEWAN WINTER GAMES ...

CNN - News Briefs - Apr. 22, 1996
WASHINGTON (CNN) -- Top financial officials from the world's seven richest industrial nations gathered in Washington ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH. TRANSCRIPT. Apr 22, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

The New Yorker Digital Edition : Apr ...
The New Yorker : Apr 22, 1996. Contents. Comment. Cartoon. The Current Cinema. The Talk of the Town. The Talk of the Town. Cartoon ...

Reissue Applications Notice - OG ...
The reissue applications listed below are open to ... S.N. 08/636,029, Apr. 22, 1996, Cl. 423/489, METHOD AND ...

Hansard -- Mon., Apr. 22, 1996
BERNARD BOUDREAU: Mr. Speaker, I beg leave to table a report on the White Paper Consultation Process. I might indicate ...

Out of the Fire : Apr 22, 1996 ...
... years, 1,915 covers and 49,833 stories from PEOPLE magazine's history for you to enjoy. Apr 22, 1996 Vol. 45 No. 16 ...

Rancher Roulette by Linda ...
Monday. Apr. 22, 1996 "Prev. Next" E-mail. Share. Digg. del.icio.us. Facebook. Rancher Roulette. by Linda Hasselstrom. MONDAY 4/22 ...

AllPolitics - More Illegal Funds For ...
today formally requested that the Federal Elections Commission review his presidential campaign finances. Earlier, ...

Orono, ME - Apr 22, 1996 - Hutchins ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Apr 22, 1996. Orono, ME. Hutchins Concert Hall. Average: 0. what is this? ...

ISOFT - Home of Japanese Software
Apr.22,1996(Mon) I'm encountering hardware problems on my new IBM Aptiva. I've written my experience in the Comments. ...

ISOFT - Home of Japanese Software
There is also a new 'Tenchi Muyo' volume out. I also finished updating TV Anime list. Apr.22,1996(Mon) TV animation ...

News - Articles - 1431470 - 19960422
Apr 22 1996 12:00 AM EDT. Sex Pistols To Do It All Again. Views84. March 22, 1996 -- The legendary Sex Pistols stirred ...

News Releases - Government of ...
Apr. 23, 1996 - RAILWAY SAFETY REPORT RECEIVED ... Apr. 23, 1996 - NEW ASSURANCES REQUIRED OF MINING INDUSTRY ...

AllPolitics - Building Bridges - Apr ...
... Christian Coalition leader Ralph Reed with a group of African-American pastors whose churches have burned down. ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH. TRANSCRIPT. Apr 23, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

CS267: Notes for Lecture 27, Apr 23 1996
UNDER CONSTRUCTION. CS267: Lecture 27, Apr 23 1996. Sparse Gaussian Elimination. Table of Contents. Motivation. Overview ...

AllPolitics - Money For Intelligence ...
White House Wants To Make Intelligence Spending Public. WASHINGTON (AllPolitics, April 23) -- In another signal the ...

Kink resistant bifurcated prosthesis ...
The invention consists of an endoluminal prosthesis adapted for placement at a bifurcation ... Apr 23, 1996 ... Apr 23, 1996. 5514154 ...

CNN - The Hollywood Minute - Apr. 23 ...
"Star Trek" fans must have thought they had died and gone to Heaven. Lead characters for the popular series were ...

Hansard -- Tue., Apr. 23, 1996
I will call the House to order at this time and commence the daily business. Are there any introductions of guests before we begin? ...

IN/BUD: PMB - Pelecehan Seksual Mak
IN/BUD: PMB - Pelecehan Seksual Mak. From: apakabar@clark.net. Date: Tue Apr 23 1996 - 05:38:00 EDT. From: John MacDougall ...

World-Wide Web Access Statistics for ...
... 22 1996 5.20 4.78 42697028 7854 | Apr 23 1996 4.17 4.25 37915826 6304 | Apr 24 1996 3.11 3.10 27651551 4703 | Apr ...

Re: Intelligent Debugging Tools ...
Apr 23, 1996 6:20 pm. David Greenman ... Apr 23, 1996 7:59 pm. Marc G. Fournier ... Apr 23, 1996 8:39 pm. Michael Smith ...

Requests for Reexamination Filed ...
No. 90/004,227, Apr. 23, 1996, Cl. 514/021, ENTERAL NUTRITIONAL COMPOSITION HAVING BALANCED AMINO ACID PROFILE, ...

PEOPLE - The Irish Times - Tue, Apr ...
THE LATE French president Francois Mitterrand, settling old scores from his grave, scorns his former political rivals in two ...

Area Studies: East Timor (r)
... Studies: East Timor (r) From: apakabar@clark.net. Date: Tue Apr 23 1996 - 05:33:00 EDT. From: John MacDougall <apakabar@clark.net> ...

Indianapolis News article of April ...
From the Indianapolis News, Apr. 23, 1996 [FROM THE INDIANAPOLIS NEWS, APR. 23, 1996] Spies (Who Act) Like Us. The ...

News Releases - Government of ...
Apr. 24, 1996 - SASKPOWER POSTS A SUCCESSFUL YEAR. Apr. 24, 1996 ... Apr. 24, 1996 - GOVERNMENT SELLS ADDITIONAL CAMECO SHARES ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH. TRANSCRIPT. Apr 24, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

S. Doc. 104-13, Appropriations ...
778. PUBLIC LAW 104–131—APR. 24, 1996. CONTINUING APPROPRIATIONS FOR THE FISCAL YEAR 1996 ... Apr. 24, 1996 [H.J. Res. 175] ...

DePauw University vs Anderson ...
... DePauw University at Anderson University Apr 24, 1996 at Anderson, ... Apr 24, 1996 at Anderson, Indiana Score by Innings ...

outlookindia.com - Contents - April ...
... Apr 24, 1996 ... Apr 24, 1996. Regulars. Uk Diary ... The page 3 people, the chatterati and those in the news for ...

ANTITERRORISM AND EFFECTIVE DEATH ...
PUBLIC LAW 104–132—APR. 24, 1996 ... Apr. 24, 1996 [S. 735] 110 STAT. 1215. PUBLIC LAW 104–132—APR. 24, 1996. Sec. ...

Father by Ted Kooser | The Writer's ...
Apr. 24, 1996 "Prev. Next" E-mail. Share. Digg. del.icio.us. Facebook. Father. by Ted Kooser. WEDNESDAY 4/24. Today's ...

Resources: Online & Disk Media (r)
Resources: Online & Disk Media (r) From: apakabar@clark.net. Date: Wed Apr 24 1996 - 14:47:00 EDT. From: John MacDougall ...

Woodchester payments - The Irish ...
THE six executive directors of Woodchester Investments received remuneration, excluding the contribution to pensions, ...

1996 | News Releases | News & Media ...
Apr 24, 1996. News Releases. Archives. Downloads. News Releases 1996. April 24, 1996. Acrylic Acid and Acrylic Ester ...

1996 | News Releases | News & Media ...
... Agricultural Insecticide. Apr. 24, 1996. Acrylic Acid and Acrylic Ester Project in Thailand. Privacy. Terms of Use ...

Deaths
... Apr 24, 1996. Deaths. Publication Date: Wednesday Apr 24, 1996 ... scientist, a former colonel in charge of the Army Air Corps' ...

Hansard -- Wed., Apr. 24, 1996
We do not want any interruptions from the galleries whatever. Now, I ask the members of the House to come to order ...

Resolution 072
72. 96-H 9022. Passed in House. Apr. 24, 1996. HOUSE RESOLUTION PROCLAIMING APRIL 24, 1996 TO BE "MENTAL HEALTH ADVOCACY DAY" ...

Paid Jobs (r)
Paid Jobs (r) From: apakabar@clark.net. Date: Wed Apr 24 1996 - 13:39:00 EDT. From: John MacDougall <apakabar@clark.net> ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH. TRANSCRIPT. Apr 25, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

News Releases - Government of ...
Apr. 25, 1996 - UPSHALL PROMOTES SASKATCHEWAN PRODUCTS IN SOUTHERN TAIWAN. Apr. 24, 1996 - SASKPOWER POSTS A SUCCESSFUL YEAR ...

Chicago Reader | Issue Archives ...
Comprehensive guide to Chicago ... Google the site Search our articles archive Search for an event " Previous Issue. Next ...

GovTrack: Senate Vote #85 (Apr 25, 1996)
A vote in the U.S. Congress. ... On the Motion to Table (motion to table the motion to recommit ) ... Apr 25, 1996 6:12PM. Result: ...

CNN - It's the pits - Apr. 25, 1996
But the oil that once gushed here has slowed to a trickle as the area recovers from the worst drought in a century. ...

DePauw University vs IUPUI (Apr 25, 1996)
... DePauw University at IUPUI Apr 25, 1996 at Indianapolis, Ind. DePauw ... at IUPUI - Play-by-Play Apr 25, 1996 at ...

IDRA: Historical Prices for Idera ...
Apr 25, 1996. 7.75. 8.00. 7.75. 8.00. 200. 320.00. Apr 24, 1996. 8.00. 8.00. 7.75. 7.75. 100. 310.00. Apr 23, 1996. 8.13. 8.13 ...

CNN - Chinese astronomers report ...
BEIJING, China -- Chinese astronomers say their observations show the nucleus of comet Hyakutake has divided into ...

Hansard -- Thur., Apr. 25, 1996
I would like to call the House to order at this time to commence the daily business. By agreement, we will call ...

ISOFT - Home of Japanese Software
Apr.25,1996(Thu) The first thing I have to tell you is next week is holiday in Japan - THE GOLDEN WEEK. I also ...

LPTH: Historical Prices for ...
Apr 25, 1996. 6.50. 6.50. 6.50. 6.50. 500. 52.00. Apr 24, 1996. 5.50. 5.50. 5.50. 5.50. 0. 44.00. Apr 23, 1996. 5.50. 5.50 ...

IN/POL: TIRAS - Wawancara Munawir S
IN/POL: TIRAS - Wawancara Munawir S. From: apakabar@clark.net. Date: Thu Apr 25 1996 - 06:56:00 EDT. From: John MacDougall ...

The Herons vs ImageBuildersRobur58 ...
... Herons at ImageBuildersRobur58 Apr 25, 1996 at Apeldoorn ... Herons at ImageBuildersRobur58 - Play-by-Play Apr 25, 1996 ...

Emory University vs LaGrange College ...
... vs LaGrange College (Apr 25, 1996) ... LaGrange College Baseball 2004 Emory University at LaGrange College Apr 25, 1996 at ...

Garbage In, Garbage Out - Page 1 ...
Comments (0) By Michael Roberts Thursday, Apr 25 1996 "Because as a producer I've stayed behind the scenes for ...

News Releases - Government of ...
Apr. 26, 1996 - LA RONGE HEALTH CENTRE OFFICIALLY OPENED ... Apr. 26, 1996 - SASKPOWER TECHNOLOGY TO HELP IN UKRAINE. Apr. 26, 1996 ...

PUBLIC LAW 104–134—APR. 26, 1996 110 ...
PUBLIC LAW 104–134—APR. 26, 1996. 110 STAT. ... 104–134—APR. 26, 1996 (C) ... PUBLIC LAW 104–134—APR. 26, 1996. 26 USC 6050P. ...

Health care world >> PMS catalogue
Apr 26,1996. XL 071-960287.1. PMS-ICS-workstations. 1 of 23. Health care world >> PMS ... Apr 26,1996. XL 071-960287.1 ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH. TRANSCRIPT. Apr 26, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

BosNet NEWS / Apr. 26, 1996
From: Nermin Zukic <n6zukic@SMS. ... Subject: BosNet NEWS / Apr. 26, 1996. CONTENTS ... [02] DECISION ON ELECTIONS IN JUNE ...

* Public Law 104–134 104th Congress ...
PUBLIC LAW 104–134—APR. 26, 1996 ... Apr. 26, 1996 [H.R. 3019] 110 STAT. 1321–1 ... PUBLIC LAW 104–134—APR. 26, 1996. CONSTRUCTION ...

ISOFT - Home of Japanese Software
Apr.26,1996(Fri) For those who have been waiting, 'Aa! Megamisama' volume 13 is out. More new mangas in News. There ...

Weekly Checklist 96-17 (Apr. 26, 1996)
Search the DSP Web site for. Weekly Checklist 96-17 (Apr. 26, 1996) How to Order Publications. For use by persons ...

EasyVision family of products
TUE lezing. Apr 26,1996. XL 071-960275.1. PMS-ICS-workstations. 1 of 33. Gerrit Muller ... Apr 26,1996. XL 071-960275.1 ...

Building Sales for Friday Apr 26, 1996
Building Sales. Publication Date: Friday Apr 26, 1996 @newitem:Home sales are compiled by REM Reports Inc., a Walnut ...

S. Doc. 104-13, Appropriations ...
PUBLIC LAW 104–134—APR. 26, 1996 ... Apr. 26, 1996 [H.R. 3019] 479. PUBLIC LAW 104–134—APR. 26, 1996. LABOR, HHS, ...

S. Doc. 104-13, Appropriations ...
PUBLIC LAW 104–134—APR. 26, 1996 ... Apr. 26, 1996 [H.R. 3019] 127. PUBLIC LAW 104–134—APR. 26, 1996. COMMERCE, JUSTICE, ...

Science/AAAS | Subject Index: 26 ...
Science Apr 26 1996: 507-508. | Summary " ... Science Apr 26 1996: 509-515. | Abstract " ... Science Apr 26 1996: 516-518. ...

Montreal, QC - Apr 26, 1996 - Verdun ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Apr 26, 1996. Montreal, QC. Verdun Auditorium. Average: 5. Average: 5 (1 vote) what is this? ...

Building Permits for Friday Apr 26, 1996
Building Permits. Publication Date: Friday Apr 26, 1996. Menlo Park. 205 Marmona Drive, owner, attic ladder, $900 ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH. TRANSCRIPT. Apr 27, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

CNN - U.S. News Briefs - Apr. 27, 1996
DENVER, Colorado (CNN) -- The defense lawyer for Oklahoma City bombing suspect Terry Nichols asked the trial judge ...

WORLD Magazine | Today's News ...
Apr. 27, 1996. Caveman with convictions. Apr. 20, 1996. Children of Chernobyl. Apr. 13, 1996. Tinkering with the tax code ...

Toronto, ON - Apr 27, 1996 - Concert ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Apr 27, 1996. Toronto, ON. Concert Hall. Average: 0. what is this? Tracks ...

Castles in Spain by Amy Lowell | The ...
Saturday. Apr. 27, 1996 "Prev. Next" E-mail. Share. Digg. del.icio.us. Facebook. Castles in Spain. by Amy Lowell. SATURDAY 4/27 ...

Anderson University vs DePauw ...
DePauw Softball Anderson University at DePauw University Apr 27, 1996 at Greencastle, Indiana Anderson University ...

DePauw University Softball
Anderson University 4, DePauw University 1 (Apr 27, 1996 at Greencastle, Indiana) ... (Apr 27, 1996 at Greencastle, Indiana) ...

PEOPLE - The Irish Times - Sat, Apr ...
THE GYMNAST who captured the world's heart at the Montreal Olympics in 1276 married a fellow Olympian yesterday in a civil ...

ISOFT - Home of Japanese Software
... 3D game playing system. It's little bit too large to buy for home use but it's was fun playing it at the store. Apr.27,1996(Sat) ...

WORLD Magazine | Quotables | | Apr ...
There's no going back for conservative Marco Rubio. FULL STORY. Table of Contents View E-zine Archives Classifieds ...

ISOFT - Home of Japanese Software
Apr.27,1996 (Sat) Overseas accesses are not the only ones contributing to internet congestion. Many companies have ...

The Lancet : Volume 347, Apr 27, 1996
The Lancet is the world's leading general medical journal and specialty journals in Oncology, Neurology and Infectious Diseases. ...

<!DOCTYPE xhtml PUBLIC "-//W3C//DTD ...
... 24 : Week Ending : -1992- These 14 States produced 99% of the State:Apr 27,:Apr 20,:Apr 27,: 1996 1996 cotton crop. ...

WWW Access Statistics for the ...
Totals for Summary Period: Apr 27 1996 to Apr 20 1996 ... 1.32 1.32 6855898 371 | Apr 27 1996 13.92 13.66 70803880 3907 | Apr ...

CNN - U.S. News Briefs - Apr. 27, 1996
WASHINGTON (CNN) -- Mayor Marion Barry, admitting that he had "tell-tale signs of spiritual relapse and physical ...

BosNet NEWS / Apr. 28, 1996
BosNet NEWS / Apr. 28, 1996. From: Nermin Zukic <n6zukic@SMS.BUSINESS.UWO.CA> Bosnia-Herzegovina News Directory. CONTENTS ...

Toronto, ON - Apr 28, 1996 - Concert ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Apr 28, 1996. Toronto, ON. Concert Hall. Average: 4.5. Average: 4.5 (2 votes) what is this? ...

ISOFT - Home of Japanese Software
Apr.28,1996(Sun) More new manga came out at a book store. For a list, turn to Manga page. I just tested Nintendo Virtual boy. ...

World-Wide Web Access Statistics for ...
Totals for Summary Period: Apr 1 1996 to Apr 28 1996 ... 25831433 4285 | Apr 27 1996 1.13 1.08 9666274 1710 | Apr 28 1996 ...

TWU - TWU Libraries - 1996 TWU Update
Apr 22-Apr 28, 1996. Apr 19-Apr 21, 1996. Apr 15-Apr 21, 1996. Apr 8-Apr 14, 1996. Apr 1-Apr 7, 1996. Mar 25-Mar 31, 1996 ...

Tampa Tribune article of April 28 ...
From the Tampa Tribune, Apr. 28, 1996 [FROM THE TAMPA TRIBUNE, APR. 28, 1996] Don't Recruit Journalists As Spies ...

Off-Topic Articles (by Ariel Mazzarelli)
Apr 28, 1996 L.A. Galaxy v NY/NJ Metrostars + A History Lesson (Ariel Mazzarelli) Apr 1, 1997 Literature, The Anglo ...

CNN - Public library wired for the ...
SAN FRANCISCO, California (CNN) -- The city of San Francisco has opened the most technologically advanced library in the world. ...

Daily Transmission Statistics
... Apr 26 1996 2.62 2.59 925,774,019 116,588 | Apr 27 1996 2.31 2.12 758,396,341 102,833 | Apr 28 1996 3.22 2.90 1, ...

Meet the Press TV Show Seasons and ...
Sunday, Apr 28, 1996. Drugs in America; with Barry McCaffrey, White House drug czar; Sens. Orrin G. Hatch (R-Utah), Joseph...

Poway Center for the Performing Arts
The Capitol Steps, Apr. 28, 1996. The Smothers Brothers with Glenn Yarbrough, May 11, 1996. View Other Seasons " ...

April 28, 1996 California Angels at ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Apr 28, 1996, Angels at White Sox Box Score and Play by Play ...

allfiles.txt
All archive files size date name 1290 Dec 28 00:10 ./.cache 215 Jul 25 1997 ./.message 6821 Dec 28 1994 ./00help ...

April 28, 1996 Cleveland Indians at ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Apr 28, 1996, Indians at Blue Jays Box Score and Play by Play ...

CCN Dialup Usage for Week Ending Apr ...
... 30 ++ * ** ++ 20 ++ *** ** +10 ++ * ** + +0 ++-*0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Letters, Apr. 29, 1996 - TIME
Letters, Apr. 29, 1996. Monday, Apr. 29, 1996 ... manner, examine the historical events surrounding the origins of this religion. ...

Notebook: Apr. 29, 1996 - TIME
VERBATIM ... JANICE M. HOROWITZ, LINA LOFARO, MICHAEL QUINN, JEFFERY C. RUBIN AND ALAIN L. SANDERS Monday, Apr. 29, 1996 ...

News Releases - Government of ...
Apr. 29, 1996 - UNITED WORLD COLLEGE SCHOLARSHIP ... Apr. 29, 1996 - 1996 SPORT FISHING SEASON OPENS SOON ...

Final Adventure : Apr 29, 1996 ...
... years, 1,915 covers and 49,833 stories from PEOPLE magazine's history for you to enjoy. Apr 29, 1996 Vol. 45 No. 17 ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH. TRANSCRIPT. Apr 29, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

Hansard -- Mon., Apr. 29, 1996
... would like to express their concern about the condition of the back roads and paved roads on their particular route. ...

The New Yorker Digital Edition : Apr ...
The New Yorker : Apr 29, 1996. Contents. Comment. Cartoon. The Current Cinema. The Talk of the Town. The Talk of the Town ...

nancies.org: tour: reviews: apr.29.1996
Crash CD release party, held next door to and nearly concurrently with the other half of the CD release party, at Trax. ...

AllPolitics - A Deep Disenchantment ...
... Republcans and Democrats, but also appear to be more skeptical about the chances that a viable third party will emerge. ...

AllPolitics - Abortion And GOP - Apr ...
Some see it as a victory for maintaining the pro-life plank in the Republican platform. Though aides to presumptive ...

Indian Ocean Report 4/96
SUMMARY REPORT _WEEKLY TEMPERATURE ANOMALY MAP (IND) APR 01-APR 29 1996 ( 92-120) ID EXP END LAT END LON S.T. E.T. ...

YHOO: Historical Prices for Yahoo! ...
Apr 29, 1996. 31.50. 32.00. 30.50. 31.00. 5,928,000. 1.29. Apr 26, 1996. 32.00. 32.25. 31.25. 31.75. 7,561,600. 1.32. Apr 25, ...

Pictures from the Civil War in Liberia
PICTURES FROM THE CIVIL WAR IN LIBERIA 1989-2002 ... Photo: The Quick and the Dead (TIME, Apr 29,1996) ... (TIME, Apr 29,1996) ...

Methods for transacting electronic ...
Filing date: Apr 29, 1996. Issue date: Jul 15, 2003. Application number: 8/641,010. A novel electronic information ...

tc-list : Message: Re: Waite just a ...
Apr 29, 1996. 3:59 am ... Apr 29, 1996. 6:30 pm ... Apr 29, 1996. 6:36 pm. Hobbs et al. on Smith & Secret Mark, II ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Apr 30, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

Notebook: Apr. 29, 1996 - TIME
VERBATIM ... "I see the President and the First Lady are not here, probably someplace testifying. ...

info-cvs : Messages : 1025-1054 of 26776
info-cvs: installing and using CVS ... Message search is now enhanced, find messages faster. Take it for a spin. Best of Y! Groups ...

News Releases - Government of ...
Apr. 30, 1996 - WHITESPRUCE EMPLOYEES RECEIVE NOTICE OF TRANSFER. Apr. 29, 1996 - UPSHALL RETURNS FROM PACIFIC RIM TRADE MISSION ...

People, Apr. 22, 1996 - TIME
"Broadway" and "SAM SHEPARD play" are not words that normally belong together. After all, this is the edgy, reclusive ...

Picasa Web Albums - Himanshu
24 albums ... Some features may not work too well, but you are welcome to have a look around. Explore. Himanshu's Gallery ...

Collegiate Update Vol. 1, no.30
GYMN-L Collegiate Update. Volume 1, no. 30. Apr. 30, 1996. Final NCAA Rankings (W) USAG Collegiate Champs (M) NCAA Team Results (M) ...

Acquisitions of the Armenian ...
Acquisitions of the Armenian Research Center, Apr 1, 1996 to Apr 30, 1996. All items are books unless otherwise identified, ...

Daily Transmission Statistics
for Summary Period: Apr 1 1996 to Apr 30 1996 ... 143,082 | Apr 29 1996 3.46 2.97 1,062,608,331 153,645 | Apr 30 1996 ...

IFOR : AFSOUTH Transcript of Press ...
I would like to introduce our guest speaker today, Commodore David Wilby Royal Air Force, Director of the Joint ...

empublic: eddipTruong1996
eddipTruong1996. Title: EDDIP. Author: S.V.Truong. Date: May-1996. Type: ... 06:55 PM Apr 30 1996. 09:51 AM Apr 02 2007 ...

Absence by May Sarton | The Writer's ...
The Writer's Almanac with Garrison Keillor: 'Absence' by May Sarton, and the literary and historical notes for Monday, April 15, 1996.

AllPolitics - Court: Starr Stays ...
... the removal of Whitewater independent counsel Kenneth Starr were rebuffed today by the court that appointed him. ...

Apr
... for Apr 1, 1996 - Apr 30, 1996 page: A DATE A I R ... min)/2 ] Veg Crops Weather Data Summary for Apr 1, 1996 - Apr 30, 1996 ...

Syracuse, NY - Apr 30, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Apr 30, 1996. Syracuse, NY. Landmark Theater. Average: 0. what is this? Tracks ...

type_Document_Title_here
Erie, Pennsylvana. May 10, 1996. Warner Theater. Crash On The Levee (Down In The Flood) Man In The Long Black Coat ...

May 10, 1996 contents
May 10, 1996. News & Briefs. Features. Announcements. News & Briefs. Collegiate Teaching Awards. Doug True named ...

Senior House Vents Over Renovations ...
An article from the Friday, May 10, 1996 issue of The Tech - MIT's oldest and largest newspaper and the first newspaper ...

CNN - Helicopters collide at Camp ...
Marine helicopters collide at Camp Lejeune; 14 dead. May 10, 1996. Updated at: 3:40 p.m. EDT. CAMP LEJEUNE, North ...

FR 61 21431, May 10, 1996
Federal Register / Vol. 61, No. 92 / Friday, May 10, 1996 / Proposed Rules ... No. 92 / Friday, May 10, 1996 / Proposed Rules ...

Hansard -- Fri., May 10, 1996
Bill No. 27 - Entitled an Act Respecting the Dissolution of the Acadia Trust Company. ( Hon. Eleanor Norrie as a private member. ...

May 10, 1996
May 10, 1996. The Honorable Mark D. Stubbs. 1025 Sawtooth Boulevard. Twin Falls, ID 83301. The Honorable Robert E. Schaefer ...

Happy Birthday to Me, May 10, 1996
Happy Birthday to Me, May 10, 1996. Steven Dutch, Natural and Applied Sciences, University of Wisconsin - Green Bay ...

News Releases - Government of ...
May. 10, 1996 - FLAX DEVELOPMENT COMMISSION ESTABLISHED. May. 10, 1996 - WORKERS' ... May. 10, 1996 - CAR OWNERS URGED TO TAKE ...

Investing For Growth - Friday, May ...
Investing For Growth. What You'll Find Here | The IFG Approach Explained | The IFG Statistics Center. Friday, May 10, 1996 ...

Minutes of Board for FRIDAY, MAY 10 ...
... and 2005 to the May 10, 1996 Board meeting so ... South Coast Air Quality Management District Board on May 10, 1996. ...

CNN - The Hollywood Minute - May 10 ...
The Hollywood Minute. May 10, 1996. Web posted at: 8:30 p.m. EDT. From Entertainment Correspondent Dennis Michael ...

Community-Level Prevention of Human ...
May 10, 1996 / Vol. 45 / No. RR-6 ... May 10, 1996 ... May 10, 1996. Community-Level Prevention of. Human Immunodeficiency ...

BOARD MEETING DATE: May 10, 1996
BOARD MEETING DATE: May 10, 1996. AGENDA NO. Proposal: Set Public Hearing June 14, 1996 to Amend Rule 1136 - Wood ...

Sask Gazette, Part I, May 10, 1996
REGINA, FRIDAY, MAY 10, 1996/REGINA, VENDREDI, 10 MAI 1996 ... MAY 10, 1996. 461 ... MAY 10, 1996. 463 (ii) that ...

Star Trek: First Contact (1996)
Directed by Jonathan Frakes. With Patrick Stewart, Jonathan Frakes, Brent Spiner. Capt. Picard and his crew pursue ...

FSB Discussion Forums Calendar: July ...
W. T. F. S. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31 ...

BEST SELLERS - May 19, 1996 - List ...
Weeks This Last On Week Week List Fiction ... A journey through the Appalachian Mountains provides answers to 2 3 2 life's enigmas. ...

Information Technology Advisory ...
Information Technology Advisory ... DUKE ITAC - December 19, 1996 Minutes. DUKE ITAC - November 21, 1996 Minutes. DUKE ...

Past productions 1996-2000 - Past ...
Plays and performances at all three theatres at the National Theatre. Information on what's on and calendar of performances ...

1996 Everest disaster - Wikipedia ...
... single day of the 1996 climbing season, May 10, 1996, when eight people died on Mount Everest during summit attempts. ...

List of Hot 100 number-one singles ...
The Billboard Hot 100 is a chart that ranks the best-performing singles of the United States. Published by Billboard ...

Government Debt Annual Report 1996
General government tended to worsen its current deficits during 1993 - 1996. The level. of deficits to the GDP shows ...

The Substitute (1996)
Directed by Robert Mandel. With Tom Berenger, Raymond Cruz, William Forsythe. Visit IMDb for Photos, Showtimes, Cast, ...

1996 Mitsubishi Galant Consumer ...
I had a 1996 Galant and was able to put 185,000 miles on it before selling it to a neighbor who put well past 200, ...

HubbleSite - NewsCenter - 1996
12/17/1996 STScI-1996-37 2. Hubble Census Tracks a Stellar "Baby Boom" Analyzing the pictures of some of the most ...

MLS - Scores & Schedule Sunday ...
Major League Soccer schedule, live ... Get scores any way you want them. Follow your favorite teams with personalized team ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. May 11, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

A Guide To 1996 Numbers - Newsweek
Like the flutings of doves in love, the voices of presidential candidates sweeten the air. In the next 54 weeks ...

NBA - Scores & Schedule Thursday ...
National Basketball Association schedule, live ... Oct 30 | Oct 31 | Nov 1. Get scores any way you want them. Follow your ...

CNN - Search for survivors called ...
May 12, 1996. Web posted at: 5:00 p.m. EDT ... built at plane crash site - May 12, 1996. Families, loved ones in shock - May 12, 1996 ...

BEST SELLERS - May 12, 1996 - List ...
Published: May 12, 1996. Sign In to E-Mail ... KNEE DEEP IN paradise, by ... IT TAKES A VILLAGE, by Hillary Rodham Clinton. ...

CNN - Families, loved ones in shock ...
... in shock. May 12, 1996 ... MIAMI, Florida (CNN) -- When Chief David Paulison of Metro ... and crew - May 12, 1996 ...

The Sunday Times May 12 1996
May 12 1996. Soccer robots train for their world cup. A FOOTBALL world cup for robots is being planned for next year ...

Budapest, May 12, 1996
Budapest, May 12, 1996. Steven Dutch, Natural and Applied Sciences, University of Wisconsin - Green Bay. First-time ...

PAPERBACK BEST SELLERS - May 12 ...
PAPERBACK BEST SELLERS: May 12, 1996. Published: May 12, 1996. Sign In to E-Mail ... LET ME CALL YOU SWEETHEART, by Mary ...

Bob Dylan - Bob Links - Set List ...
London, Ontario. May 12, 1996. University Of Western Ontario. Alumni Hall. Leopard-Skin Pill-Box Hat (Bob on harp) ...

APOD: May 12, 1996 - Tracking ...
... featured, along with a brief explanation written by a professional astronomer. May 12, 1996. Tracking Saturn's Moons ...

NWS Melbourne May 12, 1996 Storm Survey
WSR-88D Imagery from the Okeechobee Tornado. May 12, 1996. Showers developing on boundary over Lake Okeechobee. ...

YouTube - Jon Anderson May 12 1996 ...
Jon Anderson May 12 1996 (4) Time And A Word ... queueJon Anderson May 12 1996 (1) I'll Find My Way Home19,550 viewsyesmuseum ...

Calendar
SEARCH ECU WebsitePeople. Division of University Advancement. University Development. Friday, July 23, 2010. Printer Friendly ...

SENDPAGE 1 "May 12, 1996"
SENDPAGE 1 "May 12, 1996" Table of contents. NAME. SYNOPSIS. DESCRIPTION. OPTIONS -a -D -f -h -I -l -n -N -p -q -R -s -t -T ...

NHL - Scores & Schedule Sunday May ...
... results for Sunday May 12, 1996 ... any way you want them. Sunday, May 12, 1996. St. Louis. Detroit. Canceled. Series tied ...

May 12, 1996 - Denison University
... Academic Programs " Music " Heisey Wind Ensemble " May 12, 1996 ... Sunday, May 12, 1996 - Swasey Chapel, Granville, Ohio ...

FAXRCVD 8 "May 12, 1996"
FAXRCVD 8 "May 12, 1996" Table of contents. NAME. SYNOPSIS. DESCRIPTION. NOTES. FILES. SEE ALSO. NAME. faxrcvd - \*(Fx ...

Picasa Web Albums - ASKÖ ...
Photos by ASKÖ KARATEZENTRUM, Jan 1, 1996 ... We're doing maintenance, but things should be back to normal soon. 1996-06-09 ...

"The Incredible Hulk" (1996)
Created by Jack Kirby, Stan Lee. With Lou Ferrigno, Matt Frewer, Mark Hamill. A nuclear scientist is afflicted with ...

Bahai News Archive -- 1996
News coverage of the Baha'i Activities and events related to the ... Bahá'í. Archive. NOTE: The contents of these press ...

AllPolitics - Dole Gaining In ...
CNN/USA TODAY/GALLUP POLL -- May 13, 1996. AllPolitics home page. News main page. Table of Contents. Search. Copyright ...

.: Albums: 1996
Lists, videos, news, rants, ... 36. Tori Amos - Boys for Pele. 35. Redman - Muddy Waters. 34. Smog - The Doctor Came at ...

1996 Indonesian motorcycle Grand ...
The 1996 Indonesian motorcycle Grand Prix was the second round of the 1996 Grand Prix motorcycle racing season. ...

"Promised Land" (1996)
Created by Martha Williamson. With Gerald McRaney, Wendy Phillips, Austin O'Brien. Visit IMDb for Photos, Showtimes, ...

Letters, May 13, 1996 - TIME
Letters, May 13, 1996. Monday, May. 13, 1996 ... There must be a way to express resentment without harming others. ...

1996 CA-TennisTrophy - Wikipedia ...
... courts at the Wiener Stadthalle in Vienna in Austria and was part of the Championship Series of the 1996 ATP Tour. ...

NHL - Scores & Schedule Wednesday ...
National Hockey League schedule, live scores ... Oct 8 | Oct 9 | Oct 10. Get scores any way you want them. Follow your ...

1996 Dodge Dakota Consumer Discussions
Updated from #817 - Today I started in 2 instead of D and it shifted fine and then when I got around 35, I switched ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. May 13, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

WWE: Subscriptions > WWECLASSICS.com ...
World Wrestling Entertainment (WWE) the recognized leader in global entertainment, featuring the unrivaled Superstars of the ring ...

Birthdays 17th January 1996 - People ...
Birthdays ... Prince Sadruddin Aga Khan, Consultant and Charge de Mission to the Secretary- General of the UN, 63; Mr Muhammad ...

Fool Portfolio Report - Monday, May ...
ALEXANDRIA, VA, May 13, 1996 -- OK, don't expect any celebrating in the Fool Portfolio recap today. ... David Gardner, May 13, 1996 ...

FSB Discussion Forums Calendar ...
T. W. T. F. S. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30 ...

1996 Dodge Ram Van - AutoTrader.com
Get information on 1996 Dodge Ram Van cars, and find 1996 Dodge Ram Van cars near you. Find expert reviews, car photos, ...

APOD: May 14, 1996 - Hubble's ...
... featured, along with a brief explanation written by a professional astronomer. May 14, 1996. Hubble's Constant and ...

May 14, 1996 Seattle Mariners at New ...
... Reference.com > Box Scores > 1996 > May 14, 1996, Mariners at Yankees Box ... Tuesday, May 14, 1996 7:35, Yankee Stadium II ...

Waiting for Guffman (1996)
Directed by Christopher Guest. With Deborah Theaker, Michael Hitchcock, Scott Williamson. An aspiring director and ...

HALIFAX REGIONAL MUNICIPALITY ...
MAY 14, 1996 ... Heritage Trust of Nova Scotia, dated May 14, 1996 - Heritage Canada - Atlantic Region, dated May 14, 1996 ...

MEETING OF MAY 14, 1996
MEETING OF MAY 14, 1996 (Meeting convened at 10:00 a.m. ... shall start on May 14, 1996 and shall terminate on May 13, 1997. ...

Journals, Issue 18 (May 14, 1996)
Tuesday, May 14, 1996. 2:00 p.m. ... Cohen Comeau Cools Corbin Davey De Bané DeWare Di Nino Doyle ... TUESDAY, May 14, 1996 ...

Medical Tribunal Decisions 1996
About us News and updates Registration Check a doctor's registration Doctors' Performance, Conduct & Health Complaints ...

CNN - 'There could have been an ...
May 14, 1996. Web posted at: 10:30 p.m. EDT ... Grandparents, missionaries and family of five among crash victims - May 14, 1996 ...

PUBLIC HEARING OF MAY 14, 1996
PUBLIC HEARING OF MAY 14, 1996 (Meeting convened at 2:00 p.m. and adjourned at 3:30 p.m.) PLEDGE OF ALLEGIANCE ...

type_Document_Title_here
Ann Arbor, Michigan. May 14, 1996. Michigan Theater. Crash On The Levee (Down In The Flood) Man In The Long Black Coat ...

external: April 1996
iCal Web Calendar Server ... RCOC Monthly Calendar. Navigate: Mar 3. Mar 10. Mar 17. Mar 24. Mar 31. Apr 7. Apr 14. Apr 21 ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. May 14, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

IFOR Monthly Report: April 15, 1996 ...
Information Systems Office, Defense Advanced Research ... 15, 1996 - May 14, 1996 ... for April 15, 1996 - May 14, 1996 ...

Barb Wire (1996)
Directed by David Hogan. With Amir Aboulela, Adriana Alexander, David Andriole. Post-Apocalyptic remake of "Casablanca" ...

Mission: Impossible (1996)
Directed by Brian De Palma. With Tom Cruise, Jon Voight, Emmanuelle Béart. An American agent, under false suspicion ...

1996 - QuakeWorld Wiki
A summary of QuakeWorld for the year: 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010 ...

1996 Indonesian motorcycle Grand ...
The 1996 Indonesian motorcycle Grand Prix was the second round of the 1996 Grand Prix motorcycle racing season. ...

Arizona Register Volume 2 - 1996
Secretary of State, Ken Bennett ... <% Dim StrURL strURL = Request.ServerVariables("URL") if strFocus <>"" Then strFocus ...

List of Hot 100 number-one singles ...
The Billboard Hot 100 is a chart that ranks the best-performing singles of the United States. Published by Billboard ...

HubbleSite - NewsCenter - 1996
12/17/1996 STScI-1996-37 2. Hubble Census Tracks a Stellar "Baby Boom" Analyzing the pictures of some of the most ...

Society for Creative Anachronism, Inc.
Membership data may fluctuate monthly as memberships renew on differing months. Compiled by Tom Bilodeau, Society ...

CNN - NTSB inventories plane - May ...
May 15, 1996. Web posted at: 11:55 p.m. EDT ... recover more parts of the plane that are stained with soot - May 15, 1996 ...

CNN - The Hollywood Minute - May 15 ...
The Hollywood Minute. May 15, 1996. Web posted at: 2:50 p.m. EDT. From Correspondent Dennis Michael. The show "Sister, ...

Past Programme 1996
The role, limitations and legitimacy of regulatory mechanisms in market economies. 23-25 February 1996. East Asia: ...

1996 tax changes
In 1996, for the first time, the tax return forms (T1) are not specific to your province of residence. There are ...

Fool Portfolio Report - Wednesday ...
ALEXANDRIA, VA, May 15, 1996 -- The Fool Portfolio rose and fell with the market today, but still managed to close ...

Crap From The Past - May 15, 1996 ...
Audio Archive > Community Audio > Crap From The Past - May 15, 1996 ... Crap From The Past - May 15, 1996 (May 15, 1996) ...

Charlie Rose: May 15, 1996
Search settings | Sign in. Charlie Rose: May 15, 1996. 56:54 - 3 years ago. First, a discussion about Bob Dole's ...

Picasa Web Albums - ASKÖ ...
Photos by ASKÖ KARATEZENTRUM, Jan 1, 1996 ... We're doing maintenance, but things should be back to normal soon. 1996-06-09 ...

fish 1996 Recipes at Epicurious.com
Smoked Fish Trio Gourmet, December 1996. Mom's Catfish in Claypot Epicurious, © 1996 The Best of Vietnamese and Thai Cooking ...

HubbleSite - NewsCenter - 1996
1/17/1996 STScI-1996-02 32. Disk around Star May Be Warped by Unseen Planet The Hubble telescope has provided strong ...

AllPolitics - Whitwater ...
... trial of former business partners of President Bill Clinton finally got the case this afternoon for deliberation. ...

1996 Honda Accord Cpe - AutoTrader.com
Get information on 1996 Honda Accord Cpe cars, and find 1996 Honda Accord Cpe cars near you. Find expert reviews, car ...

FSB Discussion Forums Calendar: July ...
W. T. F. S. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31 ...

AllPolitics - Dole Gaining In ...
Support For Dole -- May 16, 1996. Dole Quits Senate -- May 15, 1996. CNN/USA TODAY/GALLUP POLL -- May 13, 1996. AllPolitics ...

BEST SELLERS - May 19, 1996 - List ...
Weeks This Last On Week Week List Fiction ... A journey through the Appalachian Mountains provides answers to 2 3 2 life's enigmas. ...

PGATOUR.com - 1996 Nationwide Tour ...
This is the percent of time a player makes birdie or better on a par 5. (114) signifies Titleist golf ball usage only. ...

.: Albums: 1996
Lists, videos, news, rants, ... 36. Tori Amos - Boys for Pele. 35. Redman - Muddy Waters. 34. Smog - The Doctor Came at ...

1996 Indonesian motorcycle Grand ...
The 1996 Indonesian motorcycle Grand Prix was the second round of the 1996 Grand Prix motorcycle racing season. ...

Past productions 1996-2000 - Past ...
Plays and performances at all three theatres at the National Theatre. Information on what's on and calendar of performances ...

Category:1996 Summer Olympics ...
Wikimedia Commons has media related to: 1996 Summer Olympics. Subcategories. This category has the following 6 subcategories, ...

ACT legislation register - Firearms ...
Australian Capital Territory. as at 30 July 2010 4:26:17 PM AEST. Approved web site under the Legislation Act 2001 (ACT) ...

Government Debt Annual Report 1996
General government tended to worsen its current deficits during 1993 - 1996. The level. of deficits to the GDP shows ...

Crash (1996)
Directed by David Cronenberg. With James Spader, Holly Hunter, Elias Koteas. After getting into a serious car accident, ...

Visiting Desire (1996)
Directed by Beth B.. With Kembra Pfahler. Visit IMDb for Photos, Showtimes, Cast, Crew, Reviews, Plot Summary, Comments, ...

salads 1996 Recipes at Epicurious.com
Green Salad with Oil and Vinegar Dressing (Salade Verte à la Vinaigrette) Epicurious, November 1996 French Farmhouse Cookbook ...

1996 San Francisco Giants season ...
(Ted Robinson, Hank Greenwald, Mike Krukow, Duane Kuiper) SP Radio (Julio Gonzalez,Rene De La Rosa, Amaury Pi-Gonzalez) Contents ...

Picasa Web Albums - ASKÖ ...
Photos by ASKÖ KARATEZENTRUM, Jan 1, 1996 ... We're doing maintenance, but things should be back to normal soon. 1996-06-09 ...

HubbleSite - NewsCenter - 1996
1/17/1996 STScI-1996-02 32. Disk around Star May Be Warped by Unseen Planet The Hubble telescope has provided strong ...

ECB: 1996 Q2
The purpose of harmonised competitiveness indicators (HCIs) is to provide consistent and comparable measures of ...

Bahai News Archive -- 1996
News coverage of the Baha'i Activities and events related to the ... Bahá'í. Archive. NOTE: The contents of these press ...

1996 Toyota Corolla - AutoTrader.com
Get information on 1996 Toyota Corolla cars, and find 1996 Toyota Corolla cars near you. Find expert reviews, car photos, ...

AllPolitics - Dole Gaining In ...
New Dole Poll -- May 17, 1996. Support For Dole -- May 16, 1996. Dole Quits Senate -- May 15, 1996. CNN/USA TODAY ...

The Holy See - The Holy Father ...
1 December 1996, Visit to the Parish of San Girolamo Emiliani in Rome [Italian] 30 November 1996, Vespers of First ...

.: Albums: 1996
Lists, videos, news, rants, ... 36. Tori Amos - Boys for Pele. 35. Redman - Muddy Waters. 34. Smog - The Doctor Came at ...

1996 Indonesian motorcycle Grand ...
The 1996 Indonesian motorcycle Grand Prix was the second round of the 1996 Grand Prix motorcycle racing season. ...

May 17, 1996 Seattle Mariners at ...
... Box Scores > 1996 > May 17, 1996, Mariners at Orioles Box Score ... Friday, May 17, 1996 7:37, Oriole Park at Camden Yards ...

ER Episode Guide 1996 Season 3 ...
ER 1996 Season 3 Episode Guide of Episode 6: ... Love Among the Ruins (Original Airdate May 4, 1995) Men Plan, God Laughs ...

CNN - U.S. News Briefs - May 18, 1996
News Briefs. May 18, 1996. Web posted at: 10 p.m. EDT. Rostenkowski undergoes prostate surgery. WASHINGTON (CNN) -- Former ...

May 18, 1996
May 18, 1996. Issue 33. Phonecards On-Line is written and distributed by Alan Cohen. Return to POL Index. News and Views ...

Quirks & Quarks for May 18, 1996
Quirks & Quarks for May 18, 1996. Insect Love (18:01) In springtime a young bugs thoughts lightly turn to thoughts of reproduction. ...

CNN - Butterflies freed - May 18, 1996
May 18, 1996. Web posted at: 8:30 p.m. EDT. From Correspondent David Mattingly. MIAMI, Florida (CNN) -- A successful ...

Surviving the Chaos: May 18, 1996
Not-So-Secret Thoughts from a Grace-Filled Life in Chaos. Tuesday, May 18, 2010. May 18, 1996 ... May 18, 1996. Out of the ...

Sound Money, May 1996
MAY 18, 1996. As the baby boomers move gracefully into middle age, their parents are getting older, too. And in ...

Fresh faces - The Irish Times - Sat ...
The Irish Times - Saturday, May 18, 1996. Fresh faces. In this section " Playing to the Gallery. Like father like daughter ...

MARKET REPORT - EUROPE - The Irish ...
The Irish Times - Saturday, May 18, 1996. MARKET REPORT - EUROPE. In this section " Unilever bid for Lyons is referred ...

Program Listings for Weekend Edition ...
Weekend Edition Saturday. May 18, 1996. HOST: Scott Simon. First Hour. Davis: Following the crash last week of a ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. May 18, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

Science News Magazine - References ...
May 18, 1996. Full Text Available. References: Living Large on the Precambrian Planet ... Back to Table of Contents - May 18, 1996 ...

WEEKEND EDITION SATURDAY MAY RUNDOWNS
WEEKEND EDITION SATURDAY. WITH SCOTT SIMON. May 4, 1996. May 11, 1996. May 18, 1996. May 25, 1996. Back to Program Listings ...

bmj.com Table of Contents (May 18 ...
You are seeing this message because your web browser does not support basic web standards. Find out more about ...

Orillia, ON Opera House - May 18, 1996
Orillia, ON. Opera House - May 18, 1996. The House You Live In. Sundown. Carefree Highway. Sea Of Tranquility. Cotton Jenny ...

LA Modern - May 18, 1996
LA Modern - May 18, 1996 Prices Realized December 2003 ...

Picasa Web Albums - ASKÖ ...
Photos by ASKÖ KARATEZENTRUM, Jan 1, 1996 ... We're doing maintenance, but things should be back to normal soon. 1996-06-09 ...

1996's Music Profile – Users at Last.fm
Listen to 1996's personal radio station (50,177 tracks played). 1996's top artists: The Beatles, Radiohead, Nine Inch ...

FSB Discussion Forums Calendar: July ...
W. T. F. S. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31 ...

APOD: May 19, 1996 - Nearby Dwarf ...
... featured, along with a brief explanation written by a professional astronomer. May 19, 1996. Nearby Dwarf Galaxy Leo I ...

Profundo carmesí (1996)
Directed by Arturo Ripstein. With Regina Orozco, Daniel Giménez Cacho, Sherlyn. The life of a man who preys on unsuspecting ...

The Holy See - The Holy Father ...
1 December 1996, Visit to the Parish of San Girolamo Emiliani in Rome [Italian] 30 November 1996, Vespers of First ...

Information Technology Advisory ...
Information Technology Advisory ... DUKE ITAC - December 19, 1996 Minutes. DUKE ITAC - November 21, 1996 Minutes. DUKE ...

ER Episode Guide 1996 Season 3 ...
ER 1996 Season 3 Episode Guide of Episode 6: ... Love Among the Ruins (Original Airdate May 4, 1995) Men Plan, God Laughs ...

ACT legislation register - Firearms ...
Australian Capital Territory. as at 30 July 2010 4:26:17 PM AEST. Approved web site under the Legislation Act 2001 (ACT) ...

"Dexter's Laboratory" (1996)
Created by Genndy Tartakovsky. With Kath Soucie, Frank Welker, Allison Moore. The misadventures of a boy genius and ...

1996–97 Florida Panthers season ...
5 Awards and records. 6 Transactions. 7 Roster. 8 Draft picks. 9 Farm teams. 10 See also. 11 References. 12 External links ...

1996 National League Baseball Debuts ...
Willie Mays played his first Major League game on May 25, 1951, and went 0-for-5 at the plate. He started his career ...

Hard Evidence, Sojourners Magazine ...
Sojourners is a progressive Christian commentary on faith, politics and culture. It seeks to build a movement of spirituality ...

1996 Chicago Cubs Trades and ...
76-86, 4th NL Central, Wrigley Field, 772 R, 175 HR, 4.36 ERA, 104 E, Mgr:Riggleman, SP:Navarro 15, CL:Wendell 18, HR:Sosa 40, SB: ...

1996 Summer Olympics - Wikipedia ...
Atlanta was selected on September 18, 1990 in Tokyo, Japan, over Athens, Belgrade, Manchester, Melbourne and Toronto. ...

FSB Discussion Forums Calendar: July ...
W. T. F. S. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31 ...

Number-one hits of 1996 (Finland ...
This page was last modified on 25 March 2009 at 16:01. Text is available under the Creative Commons Attribution ...

May 20, 1996
AIR PRODUCTS TO EXPAND ITS PAULSBORO, NEW JERSEY FACILITY. PAULSBORO, N.J. (May 20, 1996) -- Air Products and Chemicals, Inc. ...

Publikationsliste 1996 - Institut ...
Publikationsliste 1996 - Institut für Immunologie - Universitätsklinikum Schleswig-Holstein - Christian-Albrechts-Universität Kiel

The Rock (1996) - Box office / business
The Rock on IMDb: Movies, TV, Celebs, and more... main details combined details full cast and crew company credits tv ...

Notebook: May 20, 1996 - TIME
VERBATIM ... JEFFERY RUBIN, ALAIN SANDERS Monday, May. 20, 1996 ... the opera La Boheme--relocated to New York City's East Village, minus that ...

May 20, 1996
Issue Date. May 20, 1996. Audit Case Number. 96-DE-202-1005. TO: John Dibella, Director, Office of Public Housing, 8AP. FROM: ...

CNN - News Almanac - May 20, 1996
May 20, 1996 "I am willing to embark on a journey for peace to the Chinese mainland..." -- Lee Teng-hui | CNNfn ...

News from Monday May 27th, 1996 ...
Current news for Kitsap, WA and its surrounding communities brought to you by Kitsap Sun. Features local Kitsap, Washington news ...

Democracy Now! | May 20, 1996
Monday, May 20, 1996. MP3 Purchase DVD/CD More Formats... Speech by Charles Kernighan. SPEECH BY CHARLES KERNIGHAN ...

Broadcasting Act 1996 (c. 55)
An Act to make new provision about the broadcasting in digital form of television and sound programme services and the ...

Bizwatch, May 20, 1996 - TIME
... SMILGIS AND ADAM ZAGORIN Monday, May. 20, 1996 ... World Communications Group, and David Pecker, CEO of Hachette Filipacchi ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. May 20, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

May 20, 1996 - Print Archive ...
May 20, 1996. News ... WEEK OF MAY 20, 1996;ATTITUDES;MIDVACATION ... LANDMARKS;THE WEEK OF MAY 20, 1996;IMAGE OF THE WEEK ...

Marge Schott Cover - Sports ...
May 20, 1996 | Volume 84, Issue 20. Letters. May 20, 1996 ... May 20, 1996 | Edited by Jack McCallum and Richard O'Brien ...

HALIFAX REGIONAL MUNICIPALITY ...
MAY 21, 1996 ... Cunard St., dated May 21, 1996 from the Cunard Street Children's Centre and requested ...

May 21, 1996
Tuesday, May 21, 1996 Lake Charles, Louisiana. The Calcasieu Parish ... Charles, Louisiana, on Tuesday, May 21, 1996, at 5:00 ...

May 21, 1996 Pittsburgh Pirates at ...
... Baseball-Reference.com > Box Scores > 1996 > May 21, 1996, Pirates at Rockies Box ... Tuesday, May 21, 1996 7:06, Coors Field ...

May 21, 1996
28. 29. 30. Year: Home | Current Month | Search Events. Copyright ©2003 TotalCalendar v1.5b6. All rights reserved. ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. May 21, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

CNN - Elvis worshipped in India town ...
Elvis worshipped in India town. May 21, 1996. Web posted at: 6:15 p.m. EDT (2215 GMT) NEW DELHI, India (CNN) -- Maybe ...

MEETING OF MAY 21, 1996
MEETING OF MAY 21, 1996 (The meeting convened at 10:00 a. ... B. Jack Osterholt submitted the Jail Report dated May 21, ...

News Release -- May 21, 1996
May 21, 1996. ROSA PONSELLE 6TH ANNUAL "ALL MARYLANDERS'" COMPETITION AND WINNERS "SHOWCASE" CONCERT. An annual Eastertime ...

Fool Portfolio Report - Tuesday, May ...
Tuesday, May 21, 1996 (FOOL ... ALEXANDRIA, VA, May 21, 1996---Always looking to run our savings account like the business ...

Official Gazette Notices for 21 May 1996
Official Gazette Notices - 21 May 1996. The Following Notices are available for downloading in a single, ZIP format ...

UNT IRC Meeting Minutes, May 21, 1996
UNT IRC Meeting Minutes, May 21, 1996. VOTING MEMBERS PRESENT: BILL BUNTAIN, CAROLYN CUNNINGHAM, PAUL DWORAK, JENNY ...

@csun.edu
May 21, 1996Inaugural Issue. INSIDE THIS ISSUE. PAGE 1. FEATURES. NORTHRIDGE IN THE NEWS. ANNOUNCEMENTS. ACHIEVEMENTS. CALENDAR ...

photoj - a cyberwire service May 21 ...
... Falcon, brood her family of four atop the Rhodes Tower in Columbus, Ohio, on Tuesday, May 21, 1996. ...

FRB: FOMC Minutes - May 21, 1996
Minutes of the Federal Open Market Committee. Meeting of May 21, 1996 ... D.C., on Tuesday, May 21, 1996, at 9:00 a.m. ...

Investing For Growth - Tuesday, May ...
Investing For Growth. What You'll Find Here | The IFG Approach Explained | The IFG Statistics Center. Tuesday, May 21, 1996 ...

Crap From The Past - May 22, 1996 ...
... Audio > Crap From The Past - May 22, 1996: Lots of Canadian Artists ... Past - May 22, 1996: Lots of Canadian Artists (May 22, 1996) ...

News Releases - Government of ...
May. 22, 1996 - UPSHALL PROCLAIMS JUNE AS AGRICULTURAL ... May. 22, 1996 - LANDMARK INFORMATION TECHNOLOGY AGREEMENT LAUNCHED ...

In this May 22, 1996 file photo ...
In this May 22, 1996 file photo, actor Peter Graves says he wasn't asked to portray his signature role in the film remake of ` ...

Democracy Now! | May 22, 1996
Wednesday, May 22, 1996. MP3 Purchase DVD/CD More Formats... Results of 5/21 primaries. Pacifica National Affairs ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. May 22, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

San Francisco - Issue: May 22, 1996 ...
... and Eric K. Arnold Published: May 22, 1996 ... By Malcolm Garcia, Gordon Young and Lisa Davis Published: May 22, 1996 ...

Daily Trojan News / Wednesday, May ...
Wednesday, May 22, 1996 / Vol. 128, No. 02 [Index for this Issue] News § Viewpoint § Diversions § Sports. § Archives ...

Gazette MAY 22, 1996
VOLUME 26, NUMBER 33 WEDNESDAY MAY 22, 1996 ISSN 1199-5246. Contents. Text Only Edition. New alumni board announces ...

May 22, 1996 Senate Minutes
May 23, 1996. MINUTES OF THE UNIVERSITY SENATE: MAY 22, 1996. ROLL CALL: Present---Acres, Altmann, Anderson-Inman, ...

Set Lists
May 22, 1996. Shank Hall Milwaukee, WI. Set 1. Goofy Town. All Is Right. One More Song About Sex. Imagine A Picture. Life's Too ...

UN Security Council SC/6222 - May 22 ...
UN. Security Council. SC/6222. 3666th Meeting (PM) May 22, 1996. Security Council Calls On Croatian Government And Local Serbs ...

Democracy Now! | Listen/Watch May 22 ...
Listen/Watch May 22, 1996. Choose a file format below: Listen. Watch. MP3 Stream. MP3 Download. More audio formats ...

FRB: Federal Reserve Board Legal ...
May 22, 1996. H. Rodgin Cohen, Esq. Sullivan & Cromwell. 125 Broad Street. New York, New York 10004-2498. Dear Mr. Cohen: ...

Tucson Weekly's Currents Section ...
May 16 - May 22, 1996. Now Hear This... Under-reported or just-plain-censored news stories you, Mr. and Mrs. America, should be ...

Tucson Weekly's Back Page Section ...
May 16 - May 22, 1996. Personals. The Phone Call That Could Change Your ... Astrology for the week of May 16 - May 22, 1996. ...

May 23, 1996
Issue Date. May 23, 1996. Audit Case Number. 96-CH-202-1008. TO: Richard B. Kruschke, Director, Office of Public ...

Democracy Now! | May 23, 1996
Thursday, May 23, 1996. MP3 Purchase DVD/CD More Formats... Politics of Meaning. There's no doubt that we're in a ...

North West Community Council Minutes ...
North West Community Council Minutes - May 23, 1996 - HRM ...

Online NewsHour: Israel's Historic ...
SECURING THE FUTURE. May 23, 1996. With major elections less than a week away, Charles Krause examines the role ...

Economic Development -- Thursday ...
[Page 1] HALIFAX, THURSDAY, MAY 23, 1996. STANDING COMMITTEE ON ECONOMIC DEVELOPMENT. 10:00 a.m. CHAIRMAN. Mr. Alan Mitchell ...

May 23, 1996 Cincinnati Reds at ...
... Baseball-Reference.com > Box Scores > 1996 > May 23, 1996, Reds at Rockies Box ... Thursday, May 23, 1996 7:06, Coors Field ...

Regular Meeting No. 20 May 23, 1996
an executive meeting on May 23, 1996, pursuant to an affirmative recorded vote and ... May 23, 1996. III. PRESENTATIONS TO ...

Archive index
May 23, 1996. June 6, 1996. June 20, 1996. July 18, 1996. Back to Intercom home page. Back to University Relations home page ...

CNN - Astronauts chat about mission ...
Astronauts chat about mission. May 23, 1996. Web posted at: 11:15 a.m. EDT. SPACE CENTER, Houston (CNN) -- Astronauts ...

Fool Portfolio Report - Thursday ...
ALEXANDRIA, VA, May 23, 1996 -- Storage -technology leader, Iomega Corporation (NASDAQ:IOMG), was ... Thursday, May 23, 1996 ...

BosNet NEWS / May 23, 1996
BosNet NEWS / May 23, 1996. Bosnia-Herzegovina News Directory - Previous Article - Next Article. From: Nermin Zukic ...

Archive index
May 23, 1996. June 6, 1996. June 20, 1996. July 18, 1996. Aug. 8, 1996. Aug. 15, 1996. Aug. 29, 1996. Sept. 12, 1996. Sept. 26, ...

SF News - May 23, 1996 - Sinclair ...
May 23, 1996 Vol . 6, No. 2. Sinclair and Nance take YWCA honours. Two Simon Fraser women were front and centre at ...

Denver - Issue: May 23, 1996 | Page ...
By Stuart Steers Published: May 23, 1996 ... By Michael Roberts and John Jesitus Published: May 23, 1996 ...

News Releases - Government of ...
May. 23, 1996 - WELLNESS GRANTS AWARDED. May. 23, 1996 - PROVINCIAL FOREST FIRE MANAGEMENT STUDY RELEASED ...

1996 Indonesian motorcycle Grand ...
The 1996 Indonesian motorcycle Grand Prix was the second round of the 1996 Grand Prix motorcycle racing season. ...

Inside, May 24, 1996
Inside Iowa State. May 24, 1996. New info booth ribbon-cutting Friday. by Michelle Johnson. Iowa State officials ...

Inside, May 24, 1996
Inside Iowa State. May 24, 1996. Focus groups report on work environment available in Parks Library. As part of an ...

May 24, 1996 Vol. 4, No. 18
May 24, 1996. Vol. 4, No. 18. Cosby, Fr. Monan Stress Gratitude. Honorees' Careers Noted In Citations. Finnegan Award ...

NHL - Scores & Schedule Wednesday ...
National Hockey League schedule, live scores ... Oct 8 | Oct 9 | Oct 10. Get scores any way you want them. Follow your ...

WWE: Subscriptions > WWECLASSICS.com ...
World Wrestling Entertainment (WWE) the recognized leader in global entertainment, featuring the unrivaled Superstars of the ring ...

CoFI -- News Archives 1996
This document will be the basis for closer investigation of the tentative language design by various CoFI task groups ...

May 24, 1996
May 24, 1996. Tim D. McGreevy, Administrator. Idaho Pea and Lentil Commission. 5071 Highway 8 West. Moscow, ID 83843 ...

Democracy Now! | May 24, 1996
Friday, May 24, 1996. MP3 Purchase DVD/CD More Formats... Afrocentricity. Last week we played an excerpt of a speech ...

Fool Portfolio Report - Friday, May ...
ALEXANDRIA, VA, May 24, 1996 -- OK, the Fool Portfolio got smooshed Friday under the treads of an Iomega tank in ...

WWE Classics - WCW Fall Brawl 1996 ...
WWE Classics Hollywood Hogan leads Team NWO versus Team WCW in War Games.. Watch Video about World Wrestling Entertainment, ...

May 24, 1996
Withdrawal/Leave Policy (June 2010) Page 1 of 3. May 24, 1996. Cornell Law School. Withdrawals and leaves of absence. ...

CNN - Interactive games getting ...
Interactive games getting wilder. May 24, 1996. Web posted at: 7:40 a.m. EDT. From Correspondent Dennis Michael ...

Queen's Printer: Gazette Part I, May ...
Location: Queen's Printer > Gazette Part I, May 24, 1996 ... Part I, May 24, 1996. Description: Gazette Part I, May 24, 1996. Document ...

Online NewsHour: Haynes Johnson ...
May 24, 1996. HAYNES JOHNSON ON THE STATE OF OUR SYSTEM. When former Senate Majority Leader George Mitchell [D-ME] ...

CNN - U.S. News Briefs - May 25, 1996
News Briefs. May 25, 1996. Web posted at: 2:35 p.m. EDT. Clintons discuss adoption option. WASHINGTON (CNN) -- First ...

APHC: Saturday, May 25, 1996
Saturday, May 25, 1996. GK: Time once again for Famous Celebrities (THEME), brought to you by MarDel, makers of CoNex. ...

CNN - Beach culture maintains U.S. ...
Beach culture maintains U.S. grip. May 25, 1996. Web posted at: 10:40 p.m. EDT. From Correspondent Michael Okwu ...

Science News Magazine - References ...
May 25, 1996. Full Text Available. References: High Insulin in Blood Ups Heart Risk ... Back to Table of Contents - May 25, 1996 ...

Popular Articles & Stories for May ...
Popular articles, stories & photos for May 25, 1996 in the Los Angeles Times news archives, including an extensive archive ...

April 26 – May 25, 1996 - University ...
April 26 – May 25, 1996. Annual B.F.A. Graduate Exhibition. Main Gallery. Category: Exhibitions. Tagged: BFA, Graduate ...

DRAMATIC PERSONA - The Irish Times ...
The Irish Times - Saturday, May 25, 1996. DRAMATIC PERSONA. In this section " No more magic bullets. Ab Gab. Just about holding ...

Program Listings for Weekend Edition ...
Weekend Edition Saturday. May 25, 1996. HOST: Scott Simon. First Hour. Simon/ Israel: Scott speaks with NPR's Eric ...

Ab Gab - The Irish Times - Sat, May ...
The Irish Times - Saturday, May 25, 1996. Ab Gab. In this section " No more magic bullets. Just about holding fire ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. May 25, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

Sound Money, May 1996
MAY 25, 1996. Think about how much the world has changed in your lifetime. This century has seen the transition ...

MediaCast - The Mermen Live @ KFJC ...
On May 25, 1996, The Mermen once again returned to the KFJC studios for another in what has become a running string ...

WORLD Magazine | Quotables | | May ...
Civil-rights attorney sheds light on refusal to enforce ... Issue: "Dole: Looking for a VP" May 25, 1996 ... May 25, 1996, ...

WORLD Magazine | Mailbag | | May 25, 96
Renewables like solar power and ... VOICES | Issue: "Dole: Looking for a VP" May 25, 1996 ... May 25, 1996, Vol. 11, No. 8 ...

Center for AIDS Research
May 25, 1996. Month. Week. Day. List © 2005 University of Alabama at Birmingham • Birmingham, Alabama 35294 • 205-934-4011 ...

APOD: May 26, 1996 - Alpha Centauri ...
... along with a brief explanation written by a professional astronomer. May 26, 1996. Alpha Centauri: The Closest Star System ...

BEST SELLERS - May 26, 1996 - List ...
Published: May 26, 1996. Sign In to E-Mail ... A divorced black woman finds romance on a Jamaican 1 1 2 holiday. ...

CNN - News Almanac - May 26, 1996
Sunday, May 26, 1996. I have to tell you, Walter, I would be surprised but not disappointed. My friends would be appalled, I'm ...

May 26, 1996 Sunday session
Twenty-fifth Session. Sunday, May 26, 1996, at Dance Home in Santa Monica (1 - 3 PM PDT) [Kylie, Talia, Reni, Nyei, ...

CNN - Searchers recover ValuJet ...
Searchers recover ValuJet cockpit voice recorder. Investigators say evidence pointing to fire is stronger. May 26, 1996 ...

PAPERBACK BEST SELLERS - May 26 ...
Weeks This On Week List Fiction ... PAPERBACK BEST SELLERS: May 26, 1996. Published: May 26, 1996. Sign In to E-Mail ...

Popular Articles & Stories for May ...
Popular articles, stories & photos for May 26, 1996 in the Los Angeles Times news archives, including an extensive archive ...

St. Mary's, May 26, 1996
A WORD FROM THE RECTOR. May 26, 1996. Our recent visitation, Called to Serve with all our Gifts, ... HTML coded May 26, 1996. ...

Press Release - Q4 FY'96 Financial ...
... of $9.1 million, or seven cents per share, for the fourth quarter of fiscal 1996, ended May 26, 1996, ...

Meeting Minutes - May 26, 1996
Meeting Minutes - May 26, 1996 ...

CNN - World News Briefs - May 26, 1996
News Briefs. May 26, 1996. Web posted at: 1:10 a.m. EDT (0510 GMT) Central African mutineers negotiate with French forces ...

May 26, 1996 | The Onion - America's ...
Oprah Secedes from U.S., Forms Independent ... May 26, 1996. Article Tools. Digg. Facebook. Stumble. Twitter. Reddit. Buzz ...

May 26, 1996 Midland, Texas Supercell
May 26, 1996. Midland, Texas Supercell. Copyright 1996 - Samuel D. Barricklow - All rights reserved. Video of this ...

May 26, 1996
High-speed modems: Hype or happenin'? May 26, 1996. Topping the wish list of nearly every user of the World-Wide ...

SRNA REVIEW OF EVENING NEWS, MAY 26 ...
SRNA REVIEW OF EVENING NEWS, MAY 26, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

- May 27, 1996
May 27, 1996 (FORTUNE Magazine) – ORPHANED BUT NOT FORSAKEN. Re "Ma Bell's Orphans" (April 1): Much has been written ...

TROUTT, FISHING IN AMERICA - May 27 ...
May 27, 1996 (FORTUNE Magazine) – Kenny Troutt, CEO of Excel Communications, is a firm believer that great fortunes ...

Volume 18, Number 43, May 27, 1996 ...
TWU Update, May 27, 1996, page 2 ... TWU Update, May 27, 1996, page 3 ... TWU Update, May 27, 1996, page 5. TWU PEOPLE , ...

AllPolitics - TIME This Week: May 27 ...
May 27, 1996. Memo: To Bob Dole. The Ghost And His Rhinoceros. The Hard Way. The Tall and Short of It. Dividing Line: ...

Notebook: May 27, 1996 - TIME
... ALAIN L. SANDERS Monday, May. 27, 1996 ... Next week's showdown in Israel between Labor's Shimon Peres and Likud's ...

Letters, May 27, 1996 - TIME
WHAT PRICE CAMELOT? ... Letters, May 27, 1996. Monday, May. 27, 1996 ... "Over the years, many have proclaimed the death of ...

Democracy Now! | May 27, 1996
Monday, May 27, 1996. MP3 Purchase DVD/CD More Formats... POLITICAL HEADLINES. Veterans Hospital Closures. The ...

News Releases - Government of ...
May. 27, 1996 - EXEMPLARY CORRECTIONS SERVICE HONOURED. May. 27, 1996 ... May. 27, 1996 - ENERGY AND MINES INTERNET SITE LAUNCHED ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. May 27, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

Monday, May 27, 1996 (050)
Publications - May 27, 1996 (Previous - Next) ... Monday, May 27, 1996 ... Monday, May 27, 1996. The House met at 11 a.m. ...

BW Online | May 27, 1996 ...
BusinessWeek: May 27, 1996. Investment Figures of the Week. Investment Figures of the Week. COMMENTARY. With the ...

CNN - News Almanac - May 27, 1996
May 27, 1996 "I said a short prayer and said 'God, I haven't prayed for you to help us find this box." -- Homicide Sergeant ...

Charlie Rose May 27 1996
Search settings | Sign in. Charlie Rose May 27 1996. 53:50 - 4 years ago. Carl Sagan, Astronomer/Author, The Demon ...

BEST SELLERS - May 26, 1996 - List ...
Weeks This Last On Week Week List Fiction ... ( Simon & Schuster, $24.) A fashion photographer, investigating the ...

Phil Jackson Cover - Sports ...
May 27, 1996 | Volume 84, Issue 21 ... May 27, 1996 ... May 27, 1996 | Edited by Jack McCallum and Richard O'Brien ...

May 28, 1996 Large Supercell/Tornado ...
On May 28, 1996, a severe thunderstorm developed over south-central Indiana, then split into two separate severe ...

May 28, 1996
... COMMISSIONS NEW HYDROGEN PLANT IN THE LOS ANGELES BASIN. ALLENTOWN, PA (May 28, 1996) -- Air Products and Chemicals, Inc. ...

Johns Hopkins Gazette: May 28, 1996
May 28, 1996. Vol. 25 No. 35. Ogata, Bush encourage Class of 1996. Bloomberg among newly elected board members. In Brief ...

HALIFAX REGIONAL MUNICIPALITY ...
MAY 28, 1996 ... MAY 28, 1996. No vote was ... A copy of Mr. Weickert's presentation dated May 28, 1996, was passed to the ...

Tornadoes of May 28, 1996
May 28, 1996. Counties: Harrison IN. F-scale: F2 ... May 28, 1996. Counties: ... May 28, 1996. Counties: Anderson, Woodford ...

Journals, Issue 22 (May 28, 1996)
Tuesday, May 28, 1996. 2:00 p.m. ... Carney Carstairs Cochrane Cogger Cohen Comeau Cools Corbin ... TUESDAY, May 28, 1996 ...

May 28, 1996
and observation noise that is non-additive or non-Gaussian. In most such in- ting methods apply. Thus, there is ...

CNN - The Hollywood Minute - May 28 ...
The Hollywood Minute. May 28, 1996. Web posted at: 2:50 p.m. EDT. From Correspondent Dennis Michael "Mission Impossible" ...

Tuesday, May 28, 1996(0)
It seems as if cab drivers don't always show up when they should. I guess the next time I'll probably have to take ...

MEETING OF MAY 28, 1996
... period shall start May 28, 1996 and shall terminate ... Operator of the Year and designating Tuesday, May 28, 1996 as Frank ...

CNN - News Almanac - May 28, 1996
May 28, 1996 "We have remained enormously committed and connected to Israel and its security. And we see the glimmer ...

NA Digest, V. 96, # 21
NA Digest Tuesday, May 28, 1996 Volume 96 : Issue 21. Today's Editor: Cleve Moler. The MathWorks, Inc. moler@mathworks.com ...

CURRENT: May 28, 1996
On May 28, 1996, 8:00 p.m. EDT, Judy Anderson will visit the Tuesday Cafe to talk about her essay "Not for the ...

Johns Hopkins Gazette
... Issues April thru June 1996. June 24, 1996. June 10, 1996. May 28, 1996. May 20, 1996. May 13, 1996. May 6, 1996. April 29, ...

News Releases - Government of ...
May. 28, 1996 - SASKATCHEWAN RECEIVES FIRST MAJOR CREDIT UPGRADE IN TWO DECADES. May. 27, 1996 - EXEMPLARY CORRECTIONS ...

Crap From The Past - May 29, 1996 ...
Audio Archive > Community Audio > Crap From The Past - May 29, 1996: Bands from Boston ... From The Past - May 29, 1996: Bands from ...

May 29, 1996
May 29, 1996. OPINION NO. 96-031. The Honorable Paul W. Cox, Jr. ... May 29, 1996. The Honorable Paul W. Cox, Jr. ...

News Releases - Government of ...
May. 29, 1996 - MADE-IN ... May. 29, 1996 - KLOPPENBURG WILDLIFE REFUGE DEDICATION AT HUMBOLDT. May. 29, 1996 - JOBSTART/FUTURE ...

CNN - The Hollywood Minute - May 29 ...
The Hollywood Minute. May 29, 1996. Web posted at: 3:45 p.m. EDT. From Correspondent Dennis Michael. Actress Janeane ...

Democracy Now! | May 29, 1996
Wednesday, May 29, 1996. MP3 Purchase DVD/CD More Formats... POLITICAL HEADLINES. Whitewater Verdicts. In Little ...

CNN - 'Mission: Impossible' TV stars ...
'Mission: Impossible' TV stars disgruntled. May 29, 1996. Web posted at: 11:00 a.m. EDT. From Senior Entertainment ...

CNN - PIs offer Simpson free ...
PIs offer Simpson free sleuthing. But will he give them the cold shoulder? May 29, 1996. Web posted at: 8:15 a.m. EDT ...

Investing For Growth - Wednesday ...
Investing For Growth. What You'll Find Here | The IFG Approach Explained | The IFG Statistics Center. Wednesday, May 29, 1996 ...

San Francisco - Issue: May 29, 1996 ...
By Heather Wisner, George Cothran and Ellen McGarrahan Published: May 29, 1996 ... and Jesse Berrett Published: May 29, 1996 ...

DEQ Press Release - May 29, 1996
... RELEASE. May 29, 1996 ... Reducing waste in metal fabrication is the topic of a June 18 workshop offered by ... May 29, 1996 ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. May 29, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

OPM News Releases -- May 1996
May 29, 1996: Washington, D.C. -- U.S. Office of Personnel Management Director Jim King today announced the assignment ...

HR 859 - "Emancipation Day ...
... 29 annual Emancipation Celebration in Upson County, Georgia, 1-30 and designate May 29, 1996, as "Emancipation Day. ...

Wednesday, May 29, 1996 (052)
Publications - May 29, 1996 (Previous ... Wednesday, May 29, 1996. STATEMENTS BY ... Wednesday, May 29, 1996. The House met ...

Wednesday, May 29, 1996(1)
Today, we will be hearing from three different groups who will be speaking to us about biotechnology. We have, from ...

1996 Other documents
Report of the Lund Committee on Child and Family Support. Early Childhood Development Interim Policy. Money laundering ...

Picasa Web Albums - ASKÖ ...
Photos by ASKÖ KARATEZENTRUM, Jan 1, 1996 ... We're doing maintenance, but things should be back to normal soon. 1996-06-09 ...

"The Incredible Hulk" (1996)
Created by Jack Kirby, Stan Lee. With Lou Ferrigno, Matt Frewer, Mark Hamill. A nuclear scientist is afflicted with ...

AllPolitics - Dole Gaining In ...
WASHINGTON (AllPolitics, May 18) -- Bob Dole's decision to resign from the Senate may have given a boost to his ...

1996 Indonesian motorcycle Grand ...
The 1996 Indonesian motorcycle Grand Prix was the second round of the 1996 Grand Prix motorcycle racing season. ...

Category:1996 Summer Olympics ...
Wikimedia Commons has media related to: 1996 Summer Olympics. Subcategories. This category has the following 6 subcategories, ...

ACT legislation register - Firearms ...
Australian Capital Territory. as at 30 July 2010 4:26:17 PM AEST. Approved web site under the Legislation Act 2001 (ACT) ...

May SolarNews 1996
Return to the top of this Newsletter? Return to the Newsletter Index? 1. Space Physics Catalog (SPyCAT) Access ...

DJ Q'HEY Play Schedule 1996
PURIFY SPECIAL - X'mas PARTY @ ROCKWEST / Shinjuku -20th December 1996. DP-1 SPECIAL PARTY @ DP-1 / Shibuya -15th ...

Investing For Growth - Thursday, May ...
Thursday, May 30, 1996. The Daily ... ISLANDIA, N.Y.--(BUSINESS WIRE)--May 30, 1996--Computer Associates International, Inc. ...

The Bridlington Harbour Revision ...
Statutory Instruments printed from this website are printed under the superintendence and authority of the Controller ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. May 30, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

WHIBCO, Inc. - Ruling, May 30, 1996 ...
... May 30, 1996. Ruling, May 30, 1996 ... May 30, 1996. To: Rosemary Stack, Esq. ... Ruling, May 30, 1996. Publications, Forms, Maps ...

Democracy Now! | May 30, 1996
Thursday, May 30, 1996. MP3 Purchase DVD/CD More Formats... Israeli Elections. The results of the Israeli election ...

bmj.com Table of Contents (November ...
You are seeing this message because your web browser does not support basic web standards. Find out more about ...

APOD: May 31, 1996 - The Pulsar ...
... featured, along with a brief explanation written by a professional astronomer. May 31, 1996. The Pulsar Powered Crab ...

World No-Tobacco Day -- May 31, 1996
World No-Tobacco Day -- May 31, 1996. World No-Tobacco Day is an ... event will be held May 31, 1996; the theme is "Sports ...

Queen's Printer: Gazette Part II ...
... Printer > Gazette Part II, May 31, 1996 ... Gazette Part II, May 31, 1996 ... 1996-05-31 Part I Gazette Part I, May 31, 1996 ...

Queen's Printer: Gazette Part I, May ...
... Queen's Printer > Gazette Part I, May 31, 1996 ... I, May 31, 1996. Description: ... Part II Gazette Part II, May 31, 1996 ...

FR 61 27308, May 31, 1996
... Vol. 61, No. 106 / Friday, May 31, 1996 / Rules and Regulations (4) Any ... 106 / Friday, May 31, 1996 / Rules and ...

CNN - The Hollywood Minute - May 31 ...
The Hollywood Minute. May 31, 1996. Web posted at: 3:30 p.m. EDT. From Correspondent Dennis Michael. Angela Lansbury ...

CNN - News Briefs - May 31, 1996
News Briefs. May 31, 1996. Web posted at: 11:30 p.m. EDT (0330 GMT) Iraq to sell oil to U.S. companies again. WASHINGTON ...

News Releases - Government of ...
May. 31, 1996 - CEASE TRADING ORDER ISSUED. May. 31, 1996 - INVESTMENT ... May. 31, 1996 - OIL RECYCLING PLANT OFFICIALLY OPENED ...

Everyday Companion Online - 05/31/96 ...
... Driving Song > Walkin' (For Your Love) > Jam > Driving Song > Holden Oversoul > Jam > You Got Yours, Ain't Life Grand ...

BosNet NEWS / May 31, 1996
Belgrade, May 31, 1996 (Press TWRA) ... Stockhlom, May 31, 1996 (Press TWRA) ... Mostar, May 31, 1996 (Press TWRA) ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. May 31, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

May Press Releases
May 31, 1996: Citizens Advisory Boards Host CIP Forums, Starting June 5 ... May 31, 1996: Homeowners Can Pay Tax Bill ...

Tori Amos Setlist Database - Show ...
Detroit, MI -- Early Show (Det1) Friday, May 31, 1996. Fox Theater. Recording Available: Yes. Data: Complete. Dew Drop Inn Tour ...

May 31, 1996
Issue Date. May 31, 1996. Audit Case Number. 96-CH-229-1009. TO: Robert J. Turner, Director of Housing, Michigan State Office ...

AllPolitics - Still Friends - May 31 ...
CNN: Netanyahu Wins -- May 31, 1996. Israel Election Won't Affect Clinton's Policy -- May 30, 1996. for articles about ...

Letters, Jun. 10, 1996 - TIME
Letters, Jun. 10, 1996. Monday, Jun. 10, 1996 ... But the movie is full of images of homes, farms and businesses completely ...

People, Jun. 10, 1996 - TIME
By Belinda Luscombe Monday, Jun. 10, 1996 ... originally conceived by schlock-hack Joe Eszterhas, don't think she has lost ...

News Releases - Government of ...
Jun. 10, 1996 - SEEDING OPERATIONS NEARING COMPLETION. Jun. 10, 1996 ... Jun. 10, 1996 - APPOINTMENTS MADE TO HONOURS ADVISORY COUNCIL ...

GovTrack: House Vote #222 (Jun 10, 1996)
A vote ... Suspend the Rules and Pass, As Amended: H R 3364 Designating the William J. ... Jun 10, 1996 5:29PM. Result: ...

Special Agent : Jun 10, 1996 ...
... years, 1,916 covers and 49,834 stories from PEOPLE magazine's history for you to enjoy. Jun 10, 1996 Vol. 45 No. 23 ...

The New Yorker Digital Edition : Jun ...
The New Yorker : Jun 10, 1996. Contents. Comment. Cartoon. The Talk of the Town. The Talk of the Town. Cartoon. The Talk of the ...

Sunrise and Sunset for U.K ...
Jun 10, 1996. Rest of night. 3:07 AM. 11:09 PM. 4:14 AM. 10:02 PM. 42° 318° 17h 47m 42s + 1m 32s. 1:08 PM. 55.9° 151.894. Jun ...

World-Wide Web Access Statistics for ...
... 1996 3.32 4.33 20267008 5523 | Jun 7 1996 0.08 0.10 454406 134 | Jun 8 1996 4.67 4.87 22793990 7782 | Jun 10 1996 ...

IN/POL: PMB - BM Diah Tutup Usia
IN/POL: PMB - BM Diah Tutup Usia. From: apakabar@clark.net. Date: Mon Jun 10 1996 - 17:13:00 EDT. From: John MacDougall ...

YHOO: Historical Prices for Yahoo! ...
Jun 10, 1996. 26.87. 26.87. 26.12. 26.50. 1,849,600. 1.10. Jun 7, 1996. 27.25. 27.25. 26.50. 26.87. 3,457,600. 1.12. Jun 6, ...

YouTube - 2 Live Crew - Fuck Shop
Release Date Jun 10, 1996<br />Studio/Live Studio<br />Mono/Stereo Stereo<br />Producer The 2 Live Crew<br />Engineer Ron Taylor; ...

Quotes for BOKF, CBSH, CFR ...
Splits: Jun 10, 1996 [5:4], Jun 10, 1997 [5:4], Jun 15, 1998 [5:4], Jun 14, 1999 [5:4], Jun 13, 2000 [5:4], Jun 18, ...

High Country News
by Christopher Smith, Jun 10, 1996 ... by Elizabeth Manning, Jun 10, 1996 ... by Michelle Mcclellan, Jun 10, 1996 ...

World-Wide Web Access Statistics for ...
... 24981285 5573 | Jun 10 1996 4.80 4.49 29314234 5322 | Jun 11 1996 3.96 4.23 27573237 4390 | Jun 12 1996 3.78 3.69 ...

World-Wide Web Access Statistics for ...
... 22 | Jun 8 1996 1.26 1.15 420765 16 | Jun 9 1996 2.51 2.13 779980 32 | Jun 10 1996 4.40 3.82 1398132 56 | Jun 11 ...

What's New at National Semiconductor
... specifications. Jun 11, 1996 – Industry's Most Accurate Single-Channel Audio Attenuator Generates Only 0.001% THD ...

Sunrise and Sunset for U.K ...
Jun 11, 1996. Rest of night. 3:07 AM. 11:11 PM. 4:14 AM. 10:03 PM. 42° 318° 17h 49m 07s + 1m 24s. 1:08 PM. 56.0° 151.911. Jun ...

Tue Jun 11 1996 Tooltime Team ...
Please ask for help as needed. *** Building 16 lab room is also available for testing *** - There may be some issues ...

World-Wide Web Access Statistics for ...
... 5.37 4.69 21962431 8935 | Jun 11 1996 5.35 4.41 20639575 8913 | Jun 12 1996 4.50 4.38 20489492 7489 | Jun 13 1996 ...

nancies.org: tour: reviews: jun.11.1996
Recently (On Broadway, Some People Do Intros) So Much To Say. Dancing Nancies. Warehouse (Rain/Toy Soldiers Intro) Lie In Our ...

OldTools Archive -- message 875
On Jun 11, 1996 12:41:23, 'polgu@p... (Patrick Olguin)' wrote: >On Tue, 11 Jun ... Jun-11-1996. Re: where did "flat" come from? ...

A brief history of hemoglobins ...
Journal List > Proc Natl Acad Sci U S A > v.93(12); Jun 11, 1996. Formats: Summary. Page Browse. PDF (1.1M) Proc ...

Below the Bassline by Ernest Ranglin ...
Jun 11 1996. Overview Edit ... Jun 11 1996. 1 other version of this release ... release dates: Jun 11 1996. view details ...

Poster
Runaway. VEVELINA RODRIGUEZ. DOB: Jun 11, 1996. Missing: Dec 4, 2009. Height: 4'0" (122 cm) Eyes: Brown. Race: White/Hisp. Age ...

CCN Dialup Usage for Week Ending Jun ...
... 40 ++ * * ++ |30 ++ * ++ 20 ++ ** * ++ 10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

OldTools Archive -- message 832
The following shows the message you requested. To get back to the list of browse results, click ... Jun-11-1996 ...

Official Gazette Notices for 1996
Week24 - Jun 11, 1996. Week25 - Jun 18, 1996. Week26 - Jun 25, 1996. Week27 - Jul 02, 1996. Week28 - Jul 09, 1996 ...

SPEIUKIIHG DEVICE - Google Patent Search
Jun 11, 1996. 5609212. Adjustable sprinkler head positioning assembly. Mar 11, 1997. Drawings. Drawing. Google Home ...

WWW Statistics for www.uiowa.edu
... 9 1996 4.35 4.23 319278430 39587 | Jun 10 1996 4.24 4.31 325693679 38598 | Jun 11 1996 4.44 4.33 326957679 40414 ...

World-Wide Web Access Statistics for ...
... 24981285 5573 | Jun 10 1996 4.80 4.49 29314234 5322 | Jun 11 1996 3.96 4.23 27573237 4390 | Jun 12 1996 3.78 3.69 ...

News Releases - Government of ...
Jun. 12, 1996 - CHANGES ... Jun. 12, 1996 - AGRICULTURE BIOTECHNOLOGY REPORT RELEASED. Jun. 12, 1996 - LINGENFELTER TO RESCHEDULE ...

Jun 12 1996
In the cool and comfortable KingFisher Room in Orchard Hotel, a total of 6 AES members with 7 non-members gathered ...

outlookindia.com - Contents - June ...
Contents | MAGAZINE | Jun 12, 1996 ... Jun 12, 1996. Regulars. Delhi Diary ... The page 3 people, the chatterati and those in ...

IN/ET: AI - Aftermath of Baucau Rio
IN/ET: AI - Aftermath of Baucau Rio. From: apakabar@clark.net. Date: Wed Jun 12 1996 - 13:08:00 EDT. From: John MacDougall ...

Sunrise and Sunset for U.K ...
Jun 12, 1996. Rest of night. 3:06 AM. 11:12 PM. 4:13 AM. 10:04 PM. 42° 318° 17h 50m 23s + 1m 16s. 1:08 PM. 56.1° 151.928. Jun ...

CCN Dialup Usage for Week Ending Jun ...
... 40 ++ * * ++ |30 ++ * ++ 20 ++ ** * ++ 10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

World-Wide Web Access Statistics for ...
... 21962431 8935 | Jun 11 1996 5.35 4.41 20639575 8913 | Jun 12 1996 4.50 4.38 20489492 7489 | Jun 13 1996 3.87 4.36 ...

YHOO: Historical Prices for Yahoo! ...
Jun 12, 1996. 25.75. 26.75. 25.75. 26.00. 2,608,000. 1.08. Jun 11, 1996. 26.12. 26.50. 25.50. 25.50. 4,243,200. 1.06. Jun 10, ...

IN/TT: Kron Aksi Kawan-kawan Leste,
IN/TT: Kron Aksi Kawan-kawan Leste, From: apakabar@clark.net. Date: Wed Jun 12 1996 - 11:56:00 EDT. From: John MacDougall ...

Whats Cooking
Publication Date: Wednesday Jun 12, 1996. Whats Cooking @credit:Joe Melena. Where: 245 Lytton Ave., former site of ...

World-Wide Web Access Statistics for ...
... 33685 | Jun 12 1996 4.90 4.45 165165211 49333 | Jun 13 1996 2.62 2.86 106126495 26341 | Jun 14 1996 1.57 1.62 60259791 ...

World-Wide Web Access Statistics for ...
... Jun 10 1996 4.80 4.49 29314234 5322 | Jun 11 1996 3.96 4.23 27573237 4390 | Jun 12 1996 3.78 3.69 24053754 4188 ...

The official Dilbert website with ...
Jun 12, 1996. 21 Votes. 2 Comments. 4.36. Apr 18, 1996. 40 Votes. 1 Comments. 4.22. Jul 14, 1995. 31 Votes. 4 Comments. No ...

Certifications
Bachelor Engineering (Elect) Jan 10, 1996. Jun 12, 1996. May 14, 1998. Jun 02, 1998 ... Jun 12, 1996 Networking Essentials ...

How do I access floppies under Linux?
You can chose an arbitrary name, I use /df0 through /df3 (and /pc0 to /pc3 respectively) because I'm used to these ...

News Releases - Government of ...
Jun. 13, 1996 - PARTNERSHIP ... Jun. 13, 1996 - WESTJET CONGRATULATED ON INAUGURAL FLIGHT TO SASKATCHEWAN. Jun. 13, 1996 - JUNE LAND ...

Chicago Reader | Issue Archives ...
Comprehensive guide to Chicago ... Google the site Search our articles archive Search for an event " Previous Issue. Next ...

Poster
Endangered Missing. CRYSTAL DITTMEYER. DOB: Apr 26, 1984. Missing: Jun 13, 1996. Age Now: 26. Sex: Female. Race: White. Hair: Brown ...

Guest Book
If you would like to be on our electronic mailing list, or if you have comments to make about the conference, please click here. ...

Issues: Law & Liberty (r)
Issues: Law & Liberty (r) From: apakabar@clark.net. Date: Thu Jun 13 1996 - 06:22:00 EDT. From: John MacDougall <apakabar@clark.net> ...

Issues: Economy (r)
Issues: Economy (r) From: apakabar@clark.net. Date: Thu Jun 13 1996 - 06:31:00 EDT. From: John MacDougall <apakabar@clark.net> ...

Sunrise and Sunset for U.K ...
Jun 13, 1996. Rest of night. 3:05 AM. 11:13 PM. 4:13 AM. 10:05 PM. 41° 319° 17h 51m 32s + 1m 08s. 1:09 PM. 56.1° 151.943. Jun ...

CCN Dialup Usage for Week Ending Jun ...
... 40 ++ * * ++ |30 ++ * ++ 20 ++ ** * ++ 10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

BHP: Basic Chart for BHP Billiton ...
Access the chart for BHP Billiton Limited Common Sto (BHP) in line, bar or candlestick type. Customize the date range ...

YHOO: Historical Prices for Yahoo! ...
Jun 13, 1996. 25.75. 26.25. 24.50. 25.50. 5,668,800. 1.06. Jun 12, 1996. 25.75. 26.75. 25.75. 26.00. 2,608,000. 1.08. Jun 11, ...

News - Phoenix - Phoenix New Times
By John Dougherty Thursday, Jun 27 1996 ... By Thursday, Jun 13 1996 ... By Amy Silverman Thursday, Jun 13 1996 ...

World-Wide Web Access Statistics for ...
... 33685 | Jun 12 1996 4.90 4.45 165165211 49333 | Jun 13 1996 2.62 2.86 106126495 26341 | Jun 14 1996 1.57 1.62 60259791 ...

King Crimson 1996 Tour Dates
Jun. 13, 1996. Dortmund. Westfalen Park. N/A. Jun. 14, 1996. Hamburg(City Nord) Stadtpark. N/A. Jun. 15, 1996. Chemnitz ...

World-Wide Web Access Statistics for ...
... Jun 13 1996 4.23 4.15 27089682 4690 | Jun 14 1996 2.19 2.36 15365688 2423 | Jun 15 1996 1.96 2.18 14212404 2168 ...

Thu Jun 13 1996 1.0b1 Testing ...
Testing notes found in the tooltime-bug discuss meeting were used as a baseline for discussion and compared to the ...

Openhouse listing for Friday Jun 14 ...
Publication Date: Friday Jun 14, 1996. Open House Listings. You can scroll through this list of openhouses or click on one of ...

Stanford Theatre Schedule for Friday ...
Publication Date: Friday Jun 14, 1996. Stanford Theatre Schedule <*C>Playing through Tuesday: The Philadelphia ...

The Investment by Robert Frost | The ...
Friday. Jun. 14, 1996 "Prev. Next" E-mail. Share. Digg. del.icio.us. Facebook. The Investment. by Robert Frost. Friday 6/14 ...

Issue #331 | Magazine Archive | More ...
by Gregg Kilday | Jun 14, 1996 ... by Heidi Siegmund Cuda | Jun 14, 1996 ... by Tom De Haven | Jun 14, 1996. Tom ...

CCN Dialup Usage for Week Ending Jun ...
... 40 ++ * * ++ |30 ++ * ++ 20 ++ ** * ++ 10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Rocket Boy | Music | EW.com
... Steven Mirkin | Jun 14, 1996 ... Originally posted Jun 14, 1996 Published in issue #331 Jun 14, 1996 Order article reprints ...

YHOO: Historical Prices for Yahoo! ...
Jun 14, 1996. 24.75. 25.50. 24.75. 24.75. 2,046,400. 1.03. Jun 13, 1996. 25.75. 26.25. 24.50. 25.50. 5,668,800. 1.06. Jun 12, ...

World-Wide Web Access Statistics for ...
... 20390729 6437 | Jun 14 1996 1.10 1.05 4903687 1838 | Jun 15 1996 1.10 1.10 5158217 1834 | Jun 16 1996 4.99 5.25 ...

WWW Statistics for www.uiowa.edu
... 4.18 3.98 300401780 38057 | Jun 13 1996 3.57 3.51 265356854 32498 | Jun 14 1996 1.41 1.49 112863374 12858 | Jun 15 ...

World-Wide Web Access Statistics for ...
... 12 1996 4.90 4.45 165165211 49333 | Jun 13 1996 2.62 2.86 106126495 26341 | Jun 14 1996 1.57 1.62 60259791 15816 ...

Science/AAAS | Subject Index: 14 ...
Science Jun 14 1996: 1587-1588. | Summary " ... Science Jun 14 1996: 1596-1597. | Summary " ... Science Jun 14 1996: 1626 ...

World-Wide Web Access Statistics for ...
... Jun 13 1996 4.23 4.15 27089682 4690 | Jun 14 1996 2.19 2.36 15365688 2423 | Jun 15 1996 1.96 2.18 14212404 2168 ...

Method and apparatus for providing ...
Filing date: Jun 14, 1996. Issue date: Feb 22, 2000. A method and apparatus for providing force feedback to a user ...

Daily Transmission Statistics
... Jun 14 1996 2.28 2.36 557,059,637 59,380 | Jun 15 1996 2.31 2.38 561,880,293 59,947 | Jun 16 1996 3.75 3.61 852, ...

Sask Gazette, Part I, Jun 14, 1996
REGINA, FRIDAY, JUNE 14, 1996/REGINA, VENDREDI, 14 JUIN 1996. The Saskatchewan Gazette. TABLE OF CONTENTS/TABLE DES MATIÈRES ...

Aarhus, Denmark - Jun 15, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jun 15, 1996. Aarhus, Denmark. Tangkrogen. Average: 0. what is this? Tracks ...

Poster
Endangered Missing. PRINCESS PEREZ. DOB: Nov 30, 1993. Missing: Jun 15, 1996. Height: 2'1" (64 cm) Eyes: Brown. Race: White/Hisp ...

Poster
NonFamily Abduction. SHANNON VERHAGE. DOB: Jun 15, 1996. Missing: Jun 3, 1997. Age Now: 14. Sex: Female. Race: White. Hair: Blonde ...

Sex, lies and androgen insensitivity ...
Journal List > CMAJ > v.154(12); Jun 15, 1996. Formats: Summary. Page Browse. PDF (395K) CMAJ. 1996 June 15; 154(12): 1829–1833. ...

Ah, Room by David Ignatow | The ...
Saturday. Jun. 15, 1996 "Prev. Next" E-mail. Share. Digg. del.icio.us. Facebook. Ah, Room. by David Ignatow. Saturday 6/15 ...

Picasa Web Albums - drware
Jun 15, 1996. Photos: 95. 1993 - DRW - Maui Underwater. Photo'a taken while working at Island Scuba in Lahaina on ...

tariqas.1996.6.v1.008
... Jun 15, 1996 20:04:08, 'Simon Bryquer <sbryquer@worldnet.att.net>' wrote: Just so there's no confusion, one never knows. ...

Sunrise and Sunset for U.K ...
Jun 15, 1996. Rest of night. 3:04 AM. 11:15 PM. 4:12 AM. 10:06 PM. 41° 319° 17h 53m 24s + 51s. 1:09 PM. 56.2° 151.972. Jun 16, 1996 ...

Harriet Vane, the Tabby Cat
Older Page counts: Jun 15, 1996 - Sep 26, 1998: 133 ... 2000: ??? Created Jun 15, 1996. Last updated Jan 22, 2000 ...

World-Wide Web Access Statistics for ...
... 20390729 6437 | Jun 14 1996 1.10 1.05 4903687 1838 | Jun 15 1996 1.10 1.10 5158217 1834 | Jun 16 1996 4.99 5.25 ...

Modelling extreme stretching of DNA.
Journal List > Nucleic Acids Res > v.24(12); Jun 15, 1996. Formats: Summary. PDF (165K) Nucleic Acids Res. 1996 ...

FYI France ejournal Jun 15, 1996
3.00 FYI France: Enewsletter and archive. by Jack Kessler, kessler@well.sf.ca.us. Jun 15, 1996 issue. This file ...

World-Wide Web Access Statistics for ...
... Jun 15 1996 1.92 2.01 74536678 19286 | Jun 16 1996 4.34 4.49 166670235 43670 | Jun 17 1996 2.99 4.12 152972925 30083 ...

Daily Transmission Statistics
... Jun 14 1996 2.28 2.36 557,059,637 59,380 | Jun 15 1996 2.31 2.38 561,880,293 59,947 | Jun 16 1996 3.75 3.61 852, ...

King Crimson 1996 Tour Dates
Jun. 15, 1996. Chemnitz. Stadthalle. N/A. Jun. 17, 1996. Prague. Palace Of Culture. N/A. Jun. 18, 1996. Presov. Amphitheatre. N/A ...

44magnum's Homepage / Entrance
This homepage contains my own CG works. ... (c)1996-2001 Taek-jin Choi(44magnum(a)hitel.net). All rights reserved. ...

Sermon Jun 16 1996
A Sermon by Ken Shillito - Winchelsea Jun 16 1996. Preaching Resources. Home. Winchelsea Church. Send me an email ...

June 16, 1996 Baltimore Orioles at ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Jun 16, 1996, Orioles at Royals Box Score and Play by Play ...

Sunrise and Sunset for U.K ...
Jun 16, 1996. Rest of night. 3:04 AM. 11:15 PM. 4:12 AM. 10:06 PM. 41° 319° 17h 54m 07s + 43s. 1:09 PM. 56.2° 151.985. Jun 17, 1996 ...

CCN Dialup Usage for Week Ending Jun ...
... 40 ++ * * ++ |30 ++ *** * ++20 ++ * ++ + *10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

World-Wide Web Access Statistics for ...
... Jun 15 1996 1.92 2.01 74536678 19286 | Jun 16 1996 4.34 4.49 166670235 43670 | Jun 17 1996 2.99 4.12 152972925 30083 ...

KC2FBV's Home Page - My Buddy Max
... Memory of Max Verity. c. OCT. 1979 - JUNE 15, 1996. File First Created: SUN JUN 16 1996. File Last Updated: THU SEP 19, 2002 ...

Daily Transmission Statistics
... 2.28 2.36 557,059,637 59,380 | Jun 15 1996 2.31 2.38 561,880,293 59,947 | Jun 16 1996 3.75 3.61 852,858,438 97,568 ...

Click to see the message monospaced ...
Date: Jun 16, 1996 2:16 AM Author: Mary Vlastnik Armon Subject: Re: [mg4180] How can this MapAt application be done more ...

World-Wide Web Access Statistics for ...
... 4.15 27089682 4690 | Jun 14 1996 2.19 2.36 15365688 2423 | Jun 15 1996 1.96 2.18 14212404 2168 | Jun 16 1996 3.67 ...

Frontier: News & Updates -- Thru ...
DaveNet piece: "Mac Web Server Performance". Sun, Jun 16, 1996. Brent Simmons puts the UCMD website on the air. ...

Server Statistics
... 13 1996 298 2472243 3.05 3.21 Jun 14 1996 442 2830523 4.52 3.67 Jun 15 1996 332 2681308 3.40 3.48 Jun 16 1996 242 ...

World-Wide Web Access Statistics for ...
... Jun 15 1996 0.86 0.89 324401 11 | Jun 16 1996 2.28 2.38 868419 29 | Jun 17 1996 3.61 2.98 1087874 46 | Jun 18 1996 ...

What I Wouldn't Do by Dorianne Laux ...
Sunday. Jun. 16, 1996 "Prev. Next" E-mail. Share. Digg. del.icio.us. Facebook. What I Wouldn't Do. by Dorianne Laux. Sunday 6/16 ...

GeoNet – alert bulletin: Jun 16 1996 ...
alert bulletin: Jun 16 1996, 8:30 am - Ruapehu Volcano. Science Alert Bulletin RUA-96/08 - Change in status. Between ...

Letters, Jun. 17, 1996 - TIME
Letters, Jun. 17, 1996. Monday, Jun. 17, 1996 ... I haven't needed a ceremony or piece of paper to okay it. ...

Bizwatch, Jun. 17, 1996 - TIME
... GREENWALD, STACY PERMAN AND ADAM ZAGORIN Monday, Jun. 17, 1996 ... Details of the probe, first obtained by the Wall Street ...

The New Yorker Digital Edition : Jun ...
The New Yorker : Jun 17, 1996. Contents. Comment. Cartoon. The Talk of the Town. The Talk of the Town. The Talk of the Town ...

From: IN%"paul_brandon@ms1.mankato ...
... VAX1.Mankato.MSUS.EDU" "PKBRANDON" CC: Subj: OOF: Clinical ... Michael on Mon, Jun 17, 1996 1:39 PM Subject: Clinical ...

Guest Book
If you would like to be on our electronic mailing list, or if you have comments to make about the conference, please click here. ...

CHECK MATES - The Irish Times - Mon ...
ALL it the influence of Blur, or Oasis, or Pulp, or any other band in the Britpop pack around at the moment.

Berlin, Germany - Jun 17, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jun 17, 1996. Berlin, Germany. Tempodrome. Average: 0. what is this? Tracks ...

Some Kind of Magic : Jun 17, 1996 ...
... years, 1,915 covers and 49,833 stories from PEOPLE magazine's history for you to enjoy. Jun 17, 1996 Vol. 45 No. 24 ...

World-Wide Web Access Statistics
... 671694 193 | Jun 17 1996 5.28 5.94 838092 224 | Jun 18 1996 3.30 3.16 446544 140 | Jun 19 1996 4.41 4.33 610940 ...

Headlines Archive: 1996
Jun 17, 1996: UW-Madison Hosts National Concrete Canoe Competition. Jun 10, 1996: Taller Microcomponents Lead to New Applications ...

CCN Dialup Usage for Week Ending Jun ...
... 40 ++ * * ++ |30 ++ * * ++ 20 ++ *** * ++10 ++-*0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Dream (Team) for Stanford's Knight ...
... still will be the U.S. men's 22-and-under World Championship Qualifying Team after the final cut is made July 6. ...

Re: AFMP--Popken/AE, Pt 2
... med.unc.edu (Greg Popken)' wrote: > >>>>aeinc@usa.pipeline.com() wrote: >>> >>>>On Jun 17, 1996 08:17:33 in article ...

PEOPLE - The Irish Times - Mon, Jun ...
THOUSANDS of supporters braving monsoon rains gathered at pro-democracy activist Aung San Suu Kyi's gate yesterday for the second ...

AN: Basic Chart for AutoNation, Inc ...
Access the chart for AutoNation, Inc. Common Stock (AN) in line, bar or candlestick type. Customize the date range ...

Image quality with EasyVision PMS ...
Jun 18,1996. 2 of 8. film ... Jun 18,1996. XLR 071-960397.1 ... Jun 18,1996. XLR 071-960397.1. PMS-ICS-workstations. 2 ...

scot59-96.htm
+Jun 18, 1996*Scotland 1 (1) Switzerland 0 (0) EC 1996, Group A Villa Park, Birmingham*18/06/96 Booth*Aberdeen for ...

Official Gazette Notices for 1996
Week25 - Jun 18, 1996. Week26 - Jun 25, 1996. Week27 - Jul 02, 1996. Week28 - Jul 09, 1996. Week29 - Jul 16, 1996 ...

CCN Dialup Usage for Week Ending Jun ...
... 30 ++ *** * ++20 ++ * ++ | *10 ++ ** + + +0 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Date: Jun 18, 1996 12:15 PM Author ...
Date: Jun 18, 1996 12:15 PM Author: Nicky Subject: Re: a paradox? On Fri, 14 Jun 1996, Vijay Fafat wrote: > Consider dx = a.exp(x) ...

DIS: Historical Prices for Walt ...
Jun 18, 1996. 62.00. 62.13. 60.88. 61.00. 3,510,600. 17.82. Jun 17, 1996. 61.50. 62.13. 61.38. 62.00. 2,166,900. 18.11. Jun 14, ...

CanLII - Poultry and Poultry ...
3. since Dec 12, 2006 (current) 2. between Dec 14, 2004 and Dec 11, 2006 (past) 1. between Jun 18, 1996 and Dec 13, 2004 (past) ...

Daily Transmission Statistics
... Jun 17 1996 3.98 4.01 947,498,536 103,450 | Jun 18 1996 4.13 4.09 965,952,670 107,252 | Jun 19 1996 4.01 3.83 904, ...

World-Wide Web Access Statistics for ...
... Jun 17 1996 4.59 3.98 18615354 7633 | Jun 18 1996 4.60 5.15 24077655 7652 | Jun 19 1996 4.81 4.57 21365017 8009 ...

World-Wide Web Access Statistics for ...
... 1.92 2.01 74536678 19286 | Jun 16 1996 4.34 4.49 166670235 43670 | Jun 17 1996 2.99 4.12 152972925 30083 | Jun 18 1996 ...

tc-list : Message: Re: OT ...
Jun 18, 1996. 8:11 pm. Re: OT Quantitative Analysis. Johann Cook replied to me off-list that the Qumran database ...

georgia.gov - UID Database
Skip to Navigation. Skip to Content. 1142 Bankhead Highway, Atlanta. Incident Date: Jun 18, 1996. NIC No: U172194030. Race: Black ...

World-Wide Web Access Statistics for ...
... 324401 11 | Jun 16 1996 2.28 2.38 868419 29 | Jun 17 1996 3.61 2.98 1087874 46 | Jun 18 1996 5.18 4.28 1563877 66 ...

Sunrise and Sunset for U.K ...
Jun 18, 1996. Rest of night. 3:03 AM. 11:16 PM. 4:12 AM. 10:07 PM. 41° 319° 17h 55m 09s + 26s. 1:10 PM. 56.3° 152.009. Jun 19, 1996 ...

Genentech: Newsroom: Press Releases ...
Tuesday, Jun 18, 1996. Activase Cleared by FDA for U.S. Marketing. Friday, Jun 07, 1996. Genentech Discontinues Pursuit ...

News Releases - Government of ...
Jun. 19, 1996 - TOUGHER IMPAIRED DRIVING LAWS FOR SASKATCHEWAN. Jun. 19, 1996 ... Jun. 19, 1996 - FARMERS ALMOST FINISHED SEEDING ...

Techwatch, Jun. 10, 1996 - TIME
THE CHIPS ARE UP--AGAIN With some analysts predicting billion-dollar sales drops for the PC industry this year, and with Oracle ...

Picasa Web Albums - Alison
25 albums ... We're doing maintenance, but things should be back to normal soon. Dolls for Folk Art Fest 2009. Sep 8, 2009 ...

info-cvs : Messages : 1754-1783 of 26776
info-cvs: installing and using CVS ... Message search is now enhanced, find messages faster. Take it for a spin. Best of Y! Groups ...

People, Jun. 3, 1996 - TIME
Her figure is one thing, but something seems to be wrong with CLAUDIA SCHIFFER's figures--either that, or nasty ...

Sunrise and Sunset for U.K ...
Jun 19, 1996. Rest of night. 3:03 AM. 11:17 PM. 4:12 AM. 10:08 PM. 41° 319° 17h 55m 27s + 17s. 1:10 PM. 56.3° 152.019. Jun 20, 1996 ...

Rail-Fax - Jun 19, 1996 | Canadian ...
Your browser does not support embedded PDF files.

DIS: Historical Prices for Walt ...
Jun 19, 1996. 61.00. 61.38. 60.88. 61.13. 3,367,500. 17.86. Jun 18, 1996. 62.00. 62.13. 60.88. 61.00. 3,510,600. 17.82. Jun 17, ...

tc-list : Message: Re: OT ...
Wed Jun 19, 1996 5:35 am. Show Message Option ... Jun 19, 1996. 9:38 am ... Jun 19, 1996. 9:36 pm. Re: OT Quantitative ...

Special Agent : Jun 10, 1996 ...
Browse 35 years of PEOPLE magazine covers and articles on the Web! Read past issues and click through every PEOPLE magazine cover!

outlookindia.com - Contents - June ...
Contents | MAGAZINE | Jun 19, 1996 ... Jun 19, 1996. Regulars. Delhi Diary ... The page 3 people, the chatterati and those in ...

Deaths
Publication Date: Wednesday Jun 19, 1996. Deaths. Publication Date: Wednesday Jun 19, 1996. Bill Palmer, film and recording pioneer ...

Frankfurt, Germany - Jun 19, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jun 19, 1996. Frankfurt, Germany. Alte Oper. Average: 0. what is this? Tracks ...

Math Forum Discussions - User ...
Jun 19, 1996 11:50 PM. 4. Russell's Paradox ... Jun 19, 1996 9:14 PM. 5. Russell's Paradox ... Jun 19, 1996 8:01 PM. 7 ...

SSIAX: Historical Prices for LEGG ...
Discover historical prices for SSIAX stock on Yahoo! Finance. View daily, weekly or monthly format back to when LEGG ...

News Releases - Government of ...
Jun. 20, 1996 - SASKPOWER ... Jun. 20, 1996 - SASKATCHEWAN AGRICULTURAL INDUSTRY STRENGTHENED. Jun. 20, 1996 - THREE TRIPARTITE ...

YHOO: Historical Prices for Yahoo! ...
Jun 20, 1996. 21.00. 21.75. 20.50. 21.75. 2,958,400. 0.91. Jun 19, 1996. 21.00. 21.50. 20.50. 20.75. 4,033,600. 0.86. Jun 18, ...

Chicago Reader | Issue Archives ...
Comprehensive guide to Chicago ... by Zapp Merryweather, Daisy Crass, The Medusa Collective. Mud, Drugs, and Speaker Hugs ...

Shofar FTP Archives: people/r ...
... X-NNTP-Posting-Host: stumpy.demon.co.uk X-Broken-Date: Thursday, Jun 20, 1996 20.49.40 X-Newsreader: Newswin Alpha ...

Best Method To Settle Tiebreaks (by ...
Jun 20, 1996 [ANALYSIS] Tiebreakers: Head-to-Head vs Goal Difference (Alan Douglas, Marcelo Weinberger, Karel Stokkermans, ...

Jun 20 Event
The event on Jun 20 1996, when Polar also appears to pass into an extended cusplike region is one of a number of ...

Nyanko's Homepage(OLD)
W e l c o m e ! To Nyanko's Homepage (updated at: Jun 20, 1996) Ume-blossoms at Sumida-Park almost have faded. A ...

What's Old
... At Sumida-gawa in 1997" (at Jul 31, 1997; taken by DSC-F1) Old Homepages. at Feb 17, 1996. at Jun 20, 1996. at Jun 21, 1996 ...

CTWM: by author
CTWM by author. 2193 messages: Starting Wed Feb 28 1996 - 00:48:17 CET, Ending Wed Jun 30 2010 - 20:48:20 CEST. sort ...

Utrecht, Netherlands - Jun 20, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jun 20, 1996. Utrecht, Netherlands. Muziekcentrum Vredenburg. Average: 0. what is this? ...

Numbers On The Site: 1996 Broken ...
1996 Broken Arrow European Tour ... 33 days (Jun 20 1996 - Jul 22 1996) ... Jun 20 1996. Hallenstadion, Zürich, Switzerland ...

AH-64D Longbow for PC - GAMESPOT.com
Longbow is a fabulous piece of work, full of attention to ... Jun 20, 1996. Review. AH-64D Longbow Review. Jun 20, 1996. AH-64D ...

Sunrise and Sunset for U.K ...
Jun 20, 1996. Rest of night. 3:03 AM. 11:17 PM. 4:12 AM. 10:08 PM. 41° 319° 17h 55m 36s + 09s. 1:10 PM. 56.3° 152.029. Jun 21, 1996 ...

Daily Transmission Statistics
... 260 | Jun 20 1996 3.44 3.42 806,792,465 89,513 | Jun 21 1996 2.42 2.56 605,458,911 62,942 | Jun 22 1996 2.50 2.62 ...

News
MOSCOW (Jun 20, 1996 09:11 a.m. EDT) -- Boris Yeltsin fired three of the most powerful members of his ...

News Releases - Government of ...
Jun. 21, 1996 - MINISTER SEEKS STRONGER TRADE TIES WITH WESTERN STATES. Jun. 20, 1996 - 5.5 PER CENT INTEREST RATE ...

Utrecht, Netherlands - Jun 21, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jun 21, 1996. Utrecht, Netherlands. Muziekcentrum Vredenburg. Average: 0. what is this? ...

They Shoot Horses, Don't They ...
... Simels | Jun 21, 1996. Share ... Originally posted Jun 21, 1996 Published in issue #332 Jun 21, 1996 Order article reprints ...

Stanford Theatre Schedule for Friday ...
Publication Date: Friday Jun 21, 1996. Stanford Theatre Schedule <*C>Playing through Tuesday: It's a Wonderful ...

Unaccustomed
Publication Date: Friday Jun 21, 1996. Unaccustomed. to disappointment. Three-time CCS champ to Stanford career ...

YHOO: Historical Prices for Yahoo! ...
Jun 21, 1996. 22.25. 22.75. 21.75. 22.25. 2,544,000. 0.93. Jun 20, 1996. 21.00. 21.75. 20.50. 21.75. 2,958,400. 0.91. Jun 19, ...

Issue #332 | Magazine Archive | More ...
by Benjamin Svetkey | Jun 21, 1996 ... by Chris Willman | Jun 21, 1996 ... by Erica K. Cardozo | Jun 21, 1996. Book ...

Nyanko's Homepage
W e l c o m e ! To Nyanko's Homepage (updated at: Jun 21, 1996) It's "the 1st" Cherry-blossoms I've seen in this Spring. ...

[binary]
... Date: 06/21/96 04:44 AM From: srosenfeld@nesdis.noaa.gov Date: Fri, Jun 21, 1996 4:44 AM Subject: import S+ graph ...

What's Old
... At Sumida-gawa in 1997" (at Jul 31, 1997; taken by DSC-F1) Old Homepages. at Feb 17, 1996. at Jun 20, 1996. at Jun 21, 1996 ...

CCN Dialup Usage for Week Ending Jun ...
... 40 ++ * * ++ |30 ++ *** * ++20 ++ * ++ + *10 ++-*0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Daily Transmission Statistics
... 260 | Jun 20 1996 3.44 3.42 806,792,465 89,513 | Jun 21 1996 2.42 2.56 605,458,911 62,942 | Jun 22 1996 2.50 2.62 ...

Battle Arena Toshinden - Overview ...
Air Date: Jun 21, 1996 to Aug 21, 1996. Episodes: 2 [Edit] Main Cast: (alphabetical) Eiji Shinjo. By Tomokazu Seki. Ellis ...

Sask Gazette, Part I, Jun 21, 1996
REGINA, FRIDAY, JUNE 21, 1996/REGINA, VENDREDI, 21 JUIN 1996. The Saskatchewan Gazette. TABLE OF CONTENTS/TABLE DES MATIÈRES ...

Papy-L by subject
Archived on: Fri Jun 21 1996 - 10:37:40 MET DST. Messages sorted by: [ date ][ thread ][ author ] Other mail archives ...

OCA Race Results
Dashiki 141 O.Cup#4, DOWNHILL. Jun.22.1996. Ontario Cycling Association. 1185 Eglinton Ave., E., Ste. 408. North York, Ontario ...

Brussels, Belgium - Jun 22, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jun 22, 1996. Brussels, Belgium. Vorst Nationaal. Average: 0. what is this? ...

Alsace - The Irish Times - Sat, Jun ...
A perennially popular Alsace Riesling from a reliable producer. Plenty of luscious fruit, racy acidity and a lingering ...

WORLD Magazine | Today's News ...
Jun. 22, 1996. Disorder in the Court. Jun. 8, 1996. Dole: Looking for a VP. May. 25, 1996. For all other archived issues ...

Pedal power - The Irish Times - Sat ...
IF you thought bikers were a hairy, undisciplined lot of reprobates, take a look at the list of people lining up to take part in ...

WORLD Magazine | At your own risk ...
Jun. 22, 1996. Disorder in the Court. Jun. 8, 1996. For all other archived issues. feed Popular Articles. Family ...

Post-Perihelion Observations of ...
1996-Jun-22 1996-Jul-15 1996-Aug-12 1996-Sep-02. ROSAT observations of comet Hyakutake in June 1996: =ROR date start dur R.A. ...

CCN Dialup Usage for Week Ending Jun ...
... 40 ++ * * ++ |30 ++ * * ++ 20 ++ *** * ++10 ++-*0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

CANOE -- JAM! Music - Artists ...
Molson Amphitheatre, Toronto - Jun 22, 1996. Celine's concert perfect rendition. By JANE STEVENSON -- Toronto Sun ...

The Lancet : Volume 347, Jun 22, 1996
The Lancet is the world's leading general medical journal and specialty journals in Oncology, Neurology and Infectious Diseases. ...

Daily Transmission Statistics
... 1996 3.44 3.42 806,792,465 89,513 | Jun 21 1996 2.42 2.56 605,458,911 62,942 | Jun 22 1996 2.50 2.62 617,801,465 ...

The official Dilbert website with ...
Jun 22, 1996. 11 Votes. 0 Comments. 4.07. Jun 19, 1996. 20 Votes. 0 Comments. 4.07. Jun 17, 1996. 13 Votes. 2 Comments. No ...

CNN - Republican weekly radio ...
Since our nation was founded over 200 years ago, the American people have held an expectation that their privacy ...

CFJ ARCHIVE (176-190)
Judge: snowgod (selected Jun 22, 1996, 08:00h New York Time) Judgement: FALSE. Statement: Rule 666 cannot suspend ...

Chickenpox and steroid cards ...
Journal List > BMJ > v.312(7046); Jun 22, 1996. Formats: Summary. Page Browse. PDF (306K) BMJ. 1996 June 22; 312(7046): 1608. ...

CNN - Hikers airlifted from Grand ...
... helicopter on Sunday as firefighters battled a nearby forest fire -- one of several burning in Arizona and Utah. ...

CCN Dialup Usage for Week Ending Jun ...
... 40 ++ * * ++ |30 ++ *** * ++20 ++ * * ++ +10 ++-*0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Daily Transmission Statistics
... 465 65,085 | Jun 23 1996 3.71 3.54 835,557,259 96,532 | Jun 24 1996 3.86 3.79 894,463,151 100,260 | Jun 25 1996 ...

News
VATICAN CITY, JUN 23, 1996 (VIS) - The Holy Father ... VATICAN CITY, JUN 23, 1996 (VIS) - "From this famous city, which very ...

World-Wide Web Access Statistics for ...
... 2.03 75187956 18802 | Jun 22 1996 1.91 1.79 66451202 19184 | Jun 23 1996 4.31 4.27 158256848 43378 | Jun 24 1996 ...

Jane Krakowski
Tartuffe - Mariane - May 30, 1996 - Jun 23, 1996. Company - April - Oct 5, 1995 - Dec 3, 1995. Grand Hotel - Flaemmchen ...

WWW Statistics for www.uiowa.edu
... 113777798 14036 | Jun 22 1996 1.75 1.87 141490162 15925 | Jun 23 1996 4.49 4.55 343440203 40832 | Jun 24 1996 4.69 ...

Frontier: News & Updates -- Thru ...
News & Updates -- Thru June 1996. Thu, Jun 27, 1996. New Technology: "Editing Object Database Text with BBEdit". Sun, Jun 23, 1996 ...

World-Wide Web Access Statistics for ...
... 3.86 25210134 3754 | Jun 21 1996 2.03 2.48 16177123 2245 | Jun 22 1996 1.75 2.36 15370613 1938 | Jun 23 1996 2.80 ...

GeoNet – alert bulletin: Jun 23 1996 ...
alert bulletin: Jun 23 1996, 10:30 am - Ruapehu Volcano. Science Alert Bulletin RUA-96/17 - Update. Seismicity emanating ...

De Spartaan vs ImageBuildersRobur58 ...
... Spartaan at ImageBuildersRobur58 Jun 23, 1996 at Apeldoorn ... Spartaan at ImageBuildersRobur58 - Play-by-Play Jun 23, 1996 ...

June 23, 1996 Houston Astros at Los ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Jun 23, 1996, Astros at Dodgers Box Score and Play by Play ...

Sunrise and Sunset for U.K ...
Jun 23, 1996. Rest of night. 3:04 AM. 11:17 PM. 4:13 AM. 10:08 PM. 41° 319° 17h 55m 13s. − 16s. 1:11 PM. 56.3° 152.053. Jun 24, ...

World-Wide Web Access Statistics for ...
... 24182556 7408 | Jun 21 1996 0.83 1.04 4858208 1384 | Jun 22 1996 0.66 0.64 3013391 1094 | Jun 23 1996 6.31 6.69 ...

TWU - TWU Libraries - 1996 TWU Update
Jun 10-Jun 23, 1996. May 27-Jun 9, 1996. May 13-May 26, 1996. May 6-May 12, 1996. Apr 29-May 5, 1996. Apr 22-Apr 28, 1996 ...

Letters, Jun. 24, 1996 - TIME
Letters, Jun. 24, 1996. Monday, Jun. 24, 1996 ... collapse of authority and a popular culture that inspires antisocial and ...

Notebook: Jun. 24, 1996 - TIME
... REID AND ALAIN L. SANDERS Monday, Jun. 24, 1996 ... integration, she was one of nine blacks to attend the all-white ...

News Releases - Government of ...
Jun. 24, 1996 - CROP DEVELOPMENT BEHIND ... Jun. 24, 1996 - STRATEGIC RESEARCH FUNDING RENEWED. Jun. 24, 1996 - SASKTEL INTRODUCES NEW ...

Differdange, Luxembourg - Jun 24 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jun 24, 1996. Differdange, Luxembourg. Hall Omnisports. Average: 0. what is this? ...

YHOO: Historical Prices for Yahoo! ...
Jun 24, 1996. 22.25. 22.25. 21.75. 21.75. 633,600. 0.91. Jun 21, 1996. 22.25. 22.75. 21.75. 22.25. 2,544,000. 0.93. Jun 20, ...

High Country News
by Ed Quillen, Jun 24, 1996. Book Reviews ... Rawlins, Jun 24, 1996. Feature ... by Tony Davis, Jun 24, 1996. Related Stories ...

Poster
Endangered Missing. JOE TARKINGTON. DOB: Jun 24, 1996. Missing: Apr 9, 1999. Age Now: 14. Sex: Male. Race: White. Hair: Sandy ...

Utah Insurance Department - Company ...
Date: Jun 24, 1996. PO BOX 30660 ... Jun 24, 1996. Bail Bond Surety-P&C. Approved ... Jun 24, 1996. Professional ...

Above all - The Irish Times - Mon ...
WHAT with Ascot last week, and the Budweiser Irish, Derby next weekend - plus weddings taking, place across the country almost on ...

Eye of the Tiger : Jun 24, 1996 ...
... years, 1,915 covers and 49,833 stories from PEOPLE magazine's history for you to enjoy. Jun 24, 1996 Vol. 45 No. 25 ...

Headlines Archive: 1996
Jun 24, 1996: Improving Polymers Through Simulation. Jun 17, 1996: UW-Madison Hosts National Concrete Canoe Competition ...

Love all - The Irish Times - Mon ...
FRANKLY, whatever other delights Euro 96 may offer, fashion has not been well served by soccer this season. Nor has ...

2nd Test: England v India at Lord's ...
Cricket scores for India in England Test Series, 2nd Test: England v India at Lord's, ... matches completed by Jun 24, 1996 ... Jun 24, 1996 ...

Daily Transmission Statistics
... 465 65,085 | Jun 23 1996 3.71 3.54 835,557,259 96,532 | Jun 24 1996 3.86 3.79 894,463,151 100,260 | Jun 25 1996 ...

CNN - Spam is glue for male bonding ...
What started out as a men-only camping trip with a few friends and brothers-in-law five years ago in the Cascades, ...

News Releases - Government of ...
Jun. 25, 1996 - SENIORS' MINISTERS TO MEET IN NEW BRUNSWICK. Jun. 25, 1996 - SGI ... Jun. 25, 1996 - COMPENSATION REPORT RELEASED ...

YHOO: Historical Prices for Yahoo! ...
Jun 25, 1996. 21.75. 22.25. 21.50. 21.75. 993,600. 0.91. Jun 24, 1996. 22.25. 22.25. 21.75. 21.75. 633,600. 0.91. Jun 21, 1996 ...

Welcome to Border "Dizzy" Collie's House
ボーダーコリーというフリスビーが得意でとてもかわいい牝犬の写真を中心に紹介。 ... Welcome to. Border Collie's House. since Jun.25, 1996 ...

DGM Live!
King Crimson - Jun. 25, 1996. The 21st gig on a 26 date European tour and the Crims are firing on all cylinders. ...

press coverage
Jun 25, 1996: Washington Post Business Section. approx Jun 25, 1996: Business Week ... Last modified: Mon Apr 14 16:07:46 EDT 1997 ...

EXCLUSIVE-PART1: Al Qaeda Excluded ...
WASHINGTON, Jun 22, 2009 (IPS) - On Jun. 25, 1996, a massive truck bomb exploded at a building in the Khobar Towers ...

Daily Transmission Statistics
... 65,085 | Jun 23 1996 3.71 3.54 835,557,259 96,532 | Jun 24 1996 3.86 3.79 894,463,151 100,260 | Jun 25 1996. 3.81 ...

Best Method To Settle Tiebreaks (by ...
... et al) Jun 25, 1996 [Analysis] Goal Difference vs Time of Possession (Jeff Ely) =Subject: [ANALYSIS] Tiebreakers: ...

Reflections on STAT3, STAT5, and ...
Journal List > Proc Natl Acad Sci U S A > v.93(13); Jun 25, 1996. Formats: Summary. Page Browse. PDF (871K) Proc ...

The Irish Times - Tue, Jun 25, 1996 ...
Now, there is an old army maxim - reprehensible as you may think it - and it says simply: "Never volunteer." " Philippe, ...

King Crimson Library
Centralino Foro Italico Rome, Italy Jun. 25, 1996. The 21st gig on a 26 date European tour and the Crims are firing on all ...

nep0396.025
TROPICAL DEPRESSION ALMA DISCUSSION NUMBER 25 NATIONAL WEATHER SERVICE MIAMI FL 8 PM PDT TUE JUN 25 1996 ...

The Irish Times - Tue, Jun 25, 1996 ...
Hysteria and the poor mouth are among the many enemies of reasoned debate. Both have long bedeviled debate on the ...

UNFY: Historical Prices for Unify ...
Jun 25, 1996. 13.75. 13.75. 12.75. 12.87. 41,200. 32.19. Jun 24, 1996. 12.87. 13.75. 12.87. 13.34. 98,400. 33.36. Jun 21, 1996 ...

Intruding by Marge Piercy | The ...
Jun. 25, 1996 "Prev. Next" E-mail. Share. Digg. del.icio.us. Facebook. Intruding. by Marge Piercy. TUESDAY 6/25 ...

News Releases - Government of ...
Jun. 26, 1996 - CHARGE LAID IN RELATION TO HANDLING OF LATIMER TRIAL. Jun. 26, 1996 - ANNUAL ... Jun. 26, 1996 - PREMIER ANNOUNCES RE ...

Stanford Theatre Schedule for ...
Publication Date: Wednesday Jun 26, 1996. Stanford Theatre Schedule <*C>Playing Wednesday and Thursday: The Kid ...

YHOO: Historical Prices for Yahoo! ...
Jun 26, 1996. 21.50. 22.00. 20.75. 21.00. 1,488,000. 0.88. Jun 25, 1996. 21.75. 22.25. 21.50. 21.75. 993,600. 0.91. Jun 24, ...

GovTrack: Senate Vote #175 (Jun 26, 1996)
A vote in the U.S. Congress. ... On the Motion to Table (motin to table wellstone amdt no. 4347 ) ... Jun 26, 1996 6:59PM. Result: ...

outlookindia.com - Contents - June ...
Contents | MAGAZINE | Jun 26, 1996 ... Jun 26, 1996. Regulars. Istanbul Diary ... The page 3 people, the chatterati and those ...

YouTube - In-Faust | Celle @ Buntes ...
Search. Browse Upload. Create Account Sign In. In-Faust | Celle @ Buntes Haus | Jun 26 1996. unARTigNYC 1,014 videos ...

World-Wide Web Access Statistics for ...
... 10497 | Jun 24 1996 5.68 5.39 25198085 9454 | Jun 25 1996 4.72 5.26 24593645 7864 | Jun 26 1996 4.94 5.09 23833592 ...

FRB: H.4.1 Release-- Factors ...
... since * Wednesday Wednesday Wednesday Jun 26, 1996 Jun 19, 1996 Jun 28, 1995 -ASSETS Gold certificate account 11, ...

mep0396.026
... DEPRESSION ALMA FORECAST/ADVISORY NUMBER 26 NATIONAL WEATHER SERVICE MIAMI FL 0900Z WED JUN 26 1996 TROPICAL ...

CCN Dialup Usage for Week Ending Jun ...
... 40 ++ * * ++ |30 ++ * ++ 20 ++ * * ++ +10 ++-*0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Liverpool, United Kingdom - Jun 26 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jun 26, 1996. Liverpool, United Kingdom. Empire. Average: 0. what is this? ...

LATE SEASON STORM JUN 26, 1996
The cool, rainy weather which had been forecasted for the past week finally arrived to the northern San Joaquin ...

Daily Transmission Statistics
3.81 3.58 844,982,363 99,109 | Jun 26 1996 3.76 3.73 881,581,716 97,772 | Jun 27 1996 3.37 3.53 832,825,394 87,505 ...

Whats Cooking
Publication Date: Wednesday Jun 26, 1996. Whats Cooking @credit:Joe Melena. Where: 7118 Oak Grove Ave. near Chestnut Street, ...

mep0396.027
... WED JUN 26 1996 TROPICAL DEPRESSION CENTER LOCATED NEAR 17.8N 104.5W AT 26/1500Z POSITION ACCURATE WITHIN 45 NM ...

News Releases - Government of ...
Jun. 27, 1996 - PROVINCE DISAPPOINTED WITH AECL DECISION. Jun. 27, 1996 - REGULATIONS CHANGED ... Jun. 27, 1996 - POLL RESULTS RELEASED ...

Chicago Reader | Issue Archives ...
The rare--and occasionally poached--Karner blue butterfly found an unlikely savior in Midwest Steel. Can we protect ...

Digest 1 of pTet-On: 7391 bases ...
Thu, Jun 27, 1996. Page. Bcl I ... Thu, Jun 27, 1996. Page. TCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATT ...

Frontier: News & Updates -- Thru ...
News & Updates -- Thru June 1996. Thu, Jun 27, 1996. New Technology: "Editing Object Database Text with BBEdit" ...

tc-list : Message: Re: Mk 14:72
Thu Jun 27, 1996 7:28 pm ... Jun 27, 1996. 8:23 pm. Re: Mk 14:72 ... Jun 27, 1996. 11:34 pm. Mark 14:72 ...

Liverpool, United Kingdom - Jun 27 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jun 27, 1996. Liverpool, United Kingdom. Empire. Average: 0. what is this? ...

YHOO: Historical Prices for Yahoo! ...
Jun 27, 1996. 21.25. 22.00. 18.25. 18.25. 7,392,000. 0.76. Jun 26, 1996. 21.50. 22.00. 20.75. 21.00. 1,488,000. 0.88. Jun 25, ...

mep0396.030
... ADVISORY NUMBER 30 NATIONAL WEATHER SERVICE MIAMI FL 0900Z THU JUN 27 1996 TROPICAL DEPRESSION CENTER LOCATED NEAR ...

CCN Dialup Usage for Week Ending Jun ...
... 40 ++ * * ++ |30 ++ * ++ 20 ++ * * ++ +10 ++-*0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

CanLII - Ontario Loan Act, 1996 (No ...
1. since Jun 27, 1996 (current) ... You can search for documents citing this ... Current version: in force since Jun 27, 1996 ...

News - Phoenix - Phoenix New Times
By John Dougherty Thursday, Jun 27 1996 ... Leckie is once again seeking donations, but this... By Thursday, Jun 27 1996 ...

Sediment Monitoring
Jun-27-1996. Sep-04-1996. Nov-12-1996. Mar-12-1997 ... Jun-27-1996. Sep-04-1996. Nov-12-1996. Mar-13-1997 ...

mep0396.029
... THU JUN 27 1996 TROPICAL DEPRESSION CENTER LOCATED NEAR 18.6N 105.4W AT 27/0300Z POSITION ACCURATE WITHIN 45 NM ...

tc-list : Message: Re: OT ...
Jun 27, 1996. 4:14 am. Mk 14:72 ... Jun 27, 1996. 2:56 pm. Re: Mk 14:72 ... Jun 27, 1996. 11:34 pm. Mark 14:72 ...

Daily Transmission Statistics
3.81 3.58 844,982,363 99,109 | Jun 26 1996 3.76 3.73 881,581,716 97,772 | Jun 27 1996 3.37 3.53 832,825,394 87,505 ...

To Our Readers: Jun. 28, 1996 - TIME
By BRUCE HALLETT PRESIDENT Friday, Jun. 28, 1996 ... It hardly takes a journalistic genius to figure out that the 1996 ...

YHOO: Historical Prices for Yahoo! ...
Jun 28, 1996. 19.50. 21.00. 19.00. 21.00. 4,067,200. 0.88. Jun 27, 1996. 21.25. 22.00. 18.25. 18.25. 7,392,000. 0.76. Jun 26, ...

Canning retires - The Irish Times ...
IRELAND striker Liam Canning last night announced his retirement from international hockey. Canning, who scored two ...

Openhouse listing for Friday Jun 28 ...
Publication Date: Friday Jun 28, 1996. Open House Listings. You can scroll through this list of openhouses or click on one of ...

Stanford Theatre Schedule for Friday ...
Publication Date: Friday Jun 28, 1996. Stanford Theatre Schedule <*C>Playing through Tuesday: Around the World ...

CCN Dialup Usage for Week Ending Jun ...
... 40 ++ * * ++ |30 ++ * ++ 20 ++ * * ++ +10 ++-*0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Styx: Greatest Hits Part II | Music ...
... Flaherty | Jun 28, 1996 ... Originally posted Jun 28, 1996 Published in issue #333-334 Jun 28, 1996 Order article reprints ...

Science/AAAS | Subject Index: 28 ...
Science Jun 28 1996: 1849-0. | Summary " ... Science Jun 28 1996: 1932-1935. | Abstract " ... Science Jun 28 1996: 1947-1950. ...

The Irish Times - Fri, Jun 28, 1996 ...
Sibelius: Violin Concerto; Serenades 1 & 2; Humoresque Op 87 No 1. AnneSophie Mutter, Staatskapelle Dresden /Andre Previn. ...

Growin' Up Too Fast: The Girl Group ...
... Mirkin | Jun 28, 1996 ... Originally posted Jun 28, 1996 Published in issue #333-334 Jun 28, 1996 Order article reprints ...

News Release Archive 1996
June 1996. Jun. 28, 1996. NIAID Awards Contract for Post-Lyme Disease Syndrome Studies. Jun. 19, 1996. Studies Shed ...

Sliders Episode Guide Season 1 - 5
The Young and the Relentless. 22. Jun 28, 1996. SL-209. Invasion. 23. Jul 12, 1996. SL-206. As Time Goes By. Ep # Airdate. Prod ...

tc-list : Message: Re: Mk 14:72
Jun 28, 1996. 6:38 pm "thief" Friends, Is it ever possible to translate "lhsths (lestes)" as "thief"; or is "brigand; ...

Status Reports
Jun 28 1996. Jul 03 1996. Jul 12 1996. Jul 19 1996. Jul 26 1996. Aug 02 1996. Aug 09 1996. Aug 23 1996. Sep 06 1996. Sep 20 ...

nep0496.005
... SPECIAL DISCUSSION NUMBER 5 NATIONAL WEATHER SERVICE MIAMI FL 10 PM PDT FRI JUN 28 1996 THIS SPECIAL ADVISORY ...

WWW Access Statistics for the ...
Totals for Summary Period: Jun 29 1996 to Jun 22 1996 ... 1.84 2.01 13355605 668 | Jun 29 1996 16.92 16.63 110728183 6126 ...

The Irish Times - Sat, Jun 29, 1996 ...
THE very jolly and sociable party planned for the Presidency launch makes you realise how rare it is to see professional ...

Naval offence - The Irish Times ...
THE Queen's birthday passed off smoothly for the British embassy with a party for several hundred at the residence of the ...

CCN Dialup Usage for Week Ending Jun ...
... 40 ++ * * ++ |30 ++ * ++ 20 ++ * * ++ +10 ++-*0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

The Lancet : Volume 347, Jun 29, 1996
The Lancet is the world's leading general medical journal and specialty journals in Oncology, Neurology and Infectious Diseases. ...

Billboard | Jun 29 1996
Since the 1991 release of Marshall Crenshaw's last studio album, "Life's Too Short," the musical landscape has changed, ...

London, United Kingdom - Jun 29 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jun 29, 1996. London, United Kingdom. Hyde Park. Average: 0. what is this? ...

Daily Transmission Statistics
... 825,394 87,505 | Jun 28 1996 2.34 2.50 591,372,056 60,863 | Jun 29 1996 2.59 2.89 683,284,642 67,268 | Jun 30 1996 ...

GeoNet – alert bulletin: Jun 29 1996 ...
alert bulletin: Jun 29 1996, 12:00 pm - Ruapehu Volcano. Science Alert Bulletin RUA-96/23 - Update. The seismic activity ...

IACES International Association of ...
Jun 22 till Jun 29, 1996. Summer Course Design and Performance of Deep Foundations. Istanbul, Turkey. Apr 29 till May 03, 1996 ...

June 29, 1996 Cleveland Indians at ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Jun 29, 1996, Indians at White Sox Box Score and Play by Play ...

txt
Sorghum: Percent Planted, Selected States -Week Ending : :-1992- State:Jun 29,:Jun 22,:Jun 29,: 1996 : ...

June 1996 - Sea Surface Temperature ...
Jun. 29, 1996. Google Earth View. Jun. 28, 1996. Google Earth View. Jun. 27, 1996. Google Earth View. Jun. 26, 1996. Google ...

ImageBuildersRobur58 vs PSV (Jun 29 ...
... ImageBuildersRobur58 at PSV Jun 29, 1996 at Eindhoven ... at PSV - Play-by-Play Jun 29, 1996 at Eindhoven ...

Helping sick doctors. Stress ...
Journal List > BMJ > v.312(7047); Jun 29, 1996. Formats: Summary. Page Browse. PDF (309K) BMJ. 1996 June 29; 312(7047): 1675. ...

PLM Group
... does not support script. QUARTER. QUARTER DATE. Q3 '96. Sep 30, 1996. Q2 '96. Jun 30, 1996. Q1 '96. Mar 31, 1996. 2003. 2002 ...

Daily Transmission Statistics
... 87,505 | Jun 28 1996 2.34 2.50 591,372,056 60,863 | Jun 29 1996 2.59 2.89 683,284,642 67,268 | Jun 30 1996 ...

Jun
... Data Summary for Jun 1, 1996 - Jun 30, 1996 page: A DATE A I R ... Summary for Jun 1, 1996 - Jun 30, 1996 page: B DATE S O I ...

Headlines Archive: 1996
NASA Funds Investigation Remote Sensing Commercialization. Nov 18, 1996: Creative Thinking May Help Retire Old Landfill Problem ...

Access statistics for Al Mashriq
Access statistics for the period: Jun 1 1996 to Jun 30 1996 ... 133941986 4406 Jun 29 1996 | 100967282 2774 Jun 30 1996 ...

nancies.org: tour: reviews: jun.11.1996
Recently (On Broadway, Some People Do Intros) So Much To Say. Dancing Nancies. Warehouse (Rain/Toy Soldiers Intro) Lie In Our ...

New Video Games - New Game Releases ...
New Video Game Releases - GameSpot offers a list of new ... New Releases Week of Jun 30, 1996 ... Release Date: Jun 30, 1996 ...

World-Wide Web Access Statistics for ...
Totals for Summary Period: Jun 1 1996 to Jun 30 1996 ... 16293006 3179 | Jun 29 1996 1.64 1.86 17672478 4037 | Jun 30 1996 ...

World-Wide Web Access Statistics for ...
Totals for Summary Period: Jun 1 1996 to Jun 30 1996 ... 1.01 4727070 1433 | Jun 29 1996 0.79 0.91 4240968 1315 | Jun 30 1996 ...

Restaurant Review: Down-home cooking ...
Gombei, a small well-established eatery on El Camino Real in Menlo Park, is not your typical Japanese restaurant. ...

Notebook: Jun. 17, 1996 - TIME
The strapping young man rescued a teenage girl from an attacker who was later charged with sexual battery. Bell, ...

oardc.ohio-state.edu/weatherarchive/...
... Data Summary for Jun 1, 1996 - Jun 30, 1996 page: A DATE A I R T E ... Summary for Jun 1, 1996 - Jun 30, 1996 page: B DATE S ...

World-Wide Web Access Statistics for ...
Totals for Summary Period: Jun 1 1996 to Jun 30 1996 ... 63379483 17349 | Jun 29 1996 1.97 1.98 73509768 19862 | Jun 30 1996 ...

Jun 30, 1996 Release
Prior to this change, the run-time Effective Userid for Web transactions was always controlled by the RUNAUTH keyword. ...

World-Wide Web Access Statistics for ...
Totals for Summary Period: Jun 1 1996 to Jun 30 1996 ... 16028357 2245 | Jun 29 1996 2.04 2.36 15388981 2255 | Jun 30 1996 ...


auction - fastforward09-micro - scienceparkrome - 1smf - vegandinner - bob6 - ess7 - area from web - same name - 365 from web zh-CHS