1996(Jul-Sep)

top > 1996(Jul-Sep)



1996 Jul-Sep
Jul
01 02 03 04 05 06 07 08 09
10 11 12 13 14 15 16 17 18 19
20 21 22 23 24 25 26 27 28 29
30 31
Aug
01 02 03 04 05 06 07 08 09
10 11 12 13 14 15 16 17 18 19
20 21 22 23 24 25 26 27 28 29
30 31
Sep
01 02 03 04 05 06 07 08 09
10 11 12 13 14 15 16 17 18 19
20 21 22 23 24 25 26 27 28 29
30

Information from web.

GovTrack: House Vote #293 (Jul 10, 1996)
... Regarding Reductions in Government Spending and Regulatory Programs ... Jul 10, 1996 12:27PM. Result: Passed ...

Stanford Theatre Schedule for ...
Publication Date: Wednesday Jul 10, 1996. Stanford Theatre Schedule <*C>Playing Wednesday and Thursday: Grandma's ...

News Releases - Government of ...
Jul. 10, 1996 - NEW INTERNET, CD-ROM PRODUCTS MADE IN SASKATCHEWAN. Jul. 9, 1996 - RENAUD RESPONDS TO GRAIN MARKETING PANEL REPORT ...

KCP&L faces uncertainty over merger ...
NEW YORK (CNNfn) - Two Midwestern utility companies are in the midst of a widely-watched takeover battle to gain ...

Tambach, Germany - Jul 10, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jul 10, 1996. Tambach, Germany. Schloss Tambach. Average: 0. what is this? ...

Theatre of Dreams FTP Application
Created: Fri Apr 17 05:42:57 GMT+00:00 1998 ... 1954 Jul 10 1996 backgr05.gif ... 18264 Jul 10 1996 bruce.jpg. 25196 ...

UNFY: Historical Prices for Unify ...
Jul 10, 1996. 10.62. 10.75. 9.75. 10.25. 5,900. 25.62. Jul 9, 1996. 11.00. 11.00. 10.62. 10.62. 6,400. 26.56. Jul 8, 1996 ...

outlookindia.com - Contents - July ...
Contents | MAGAZINE | Jul 10, 1996 ... Jul 10, 1996. Regulars. Bombay Diary ... The page 3 people, the chatterati and those ...

FRB: H.4.1 Release-- Factors ...
... since * Wednesday Wednesday Wednesday Jul 10, 1996 Jul 3, 1996 Jul 12, 1995 -ASSETS Gold certificate account 11, ...

Some artists who have appeared on ...
Publication Date: Wednesday Jul 10, 1996. Some artists who have appeared on Windham Hill or High Street: Philip Aaberg ...

Mount Gayley and Temple Crag (Moon ...
The sun was so hot on top of Mt Gayley (13,500+) that David Erskine and I sought shade under boulders to cool off. ...

The Irish Times - Wed, Jul 10, 1996 ...
Ireland's education system is remarkable in that in contrast to almost every other Western country, it. lacks an ...

tc-list : Message: Re: Patrick W. Skehan
Message search is now enhanced, find messages faster. ... Jul 10, 1996. 6:03 pm. Re: 4QPs(b) ... Jul 10, 1996. 6:22 pm. Mk 15:45 ...

News Release Archive 1996
News Releases and Statements For 1996 ... Fauci: New Findings on Host Factors Illuminate AIDS Pathogenesis ... Jul. 10, 1996 ...

rre : Messages : 429-458 of 1347
Check them out and nominate your group. ... Jul 10, 1996. 5:32 pm. 433 ... Jul 10, 1996. 8:35 pm. 434. EPIC Alert 3.13 ...

News Releases - Government of ...
Jul. 11, 1996 - SERBY ANNOUNCES CHANGES FOR SPMC ... Jul. 11, 1996 - REVIEW OF HUMAN RIGHTS CODE RELEASED. Jul. 11, 1996 - CORNERSTONE ...

FY 1996-97 E-97-1 Original Jul 11 ...
FY 1996-97. E-97-1. Original. Jul 11, 1996 ... Jul 11, 1996. 5-Mon-1 72.0/72.6 - Construct a riparian and wetland mitigation ...

UNFY: Historical Prices for Unify ...
Jul 11, 1996. 9.75. 10.25. 8.63. 8.88. 38,500. 22.19. Jul 10, 1996. 10.62. 10.75. 9.75. 10.25. 5,900. 25.62. Jul 9, 1996. 11.00 ...

Chicago Reader | Issue Archives ...
Comprehensive guide to Chicago ... Issue Archive for the Week of. Jul 11 - 17, 1996. Vol. 25, No. 40. Music. Damaged ...

The Writer's Almanac: Howard Nemerov
Jul. 11, 1996. Dec. 8, 2004. September, the First Day of School. Sep. 7, 2000. Sep. 2, 1994. Sep. 7, 1999. Snowflakes; Knowledge ...

Poster
Family Abduction. MELISSA BUSTAMANTE. DOB: Jul 11, 1996. Missing: Aug 23, 1998. Age Now: 14. Sex: Female. Race: Hispanic. Hair: ...

CCN Dialup Usage for Week Ending Jul ...
... 40 ++ *** ** +30 ++ * * ++ 20 ++ * * ++ +10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Ozone Hole Image for July 10, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. July 10, 1996. Jul. 09, 1996 · Jul. 11, 1996 ...

xfer_960712.html
TOTALS FOR SUMMARY PERIOD Thu Jul 11 1996 TO Fri Jul 12 1996 ... Thu Jul 11 1996 9160 1649668242 3.2 KB/s 99.89 99.75 Fri Jul ...

WWW Statistics for www.uiowa.edu
... 373530398 43260 | Jul 10 1996 4.39 4.78 392895693 44221 | Jul 11 1996 3.75 4.03 331602609 37749 | Jul 12 1996 1.63 ...

IN/POL: DEPLU - Security Agreement
IN/POL: DEPLU - Security Agreement. From: apakabar@clark.net. Date: Thu Jul 11 1996 - 15:54:00 EDT. From: John MacDougall ...

eightfold-l : Messages : 897-926 of 3687
Jul 11, 1996. 7:51 pm. 898. Re: Digest Number 155- Right concentration. It helps a lot to be in contact with others ...

The official Dilbert website with ...
72 Votes. 2 Comments. 4.49. Sep 10, 1996. 72 Votes. 4 Comments. 4.08. Jul 11, 1996. 20 Votes. 2 Comments. No recent mashups ...

xfer_960711.html
TOTALS FOR SUMMARY PERIOD Wed Jul 10 1996 TO Thu Jul 11 1996 ... 4.7 KB/s 99.92 99.89 Thu Jul 11 1996 10 2135336 1.8 KB/s ...

RPFRX: Historical Prices for DAVIS ...
Jul 11, 1996. 16.97. 16.97. 16.97. 16.97. 0. 6.70. Jul 10, 1996. 17.07. 17.07. 17.07. 17.07. 0. 6.74. Jul 9, 1996. 17.14. 17.14 ...

Digest 1 of pGFPuv: 3337 bases (circular)
Fri, Jul 12, 1996. Page ... Fri, Jul 12, 1996. Page. TAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACC ...

Magdeburg, Germany - Jul 12, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jul 12, 1996. Magdeburg, Germany. Stadthalle. Average: 0. what is this? Tracks ...

Openhouse listing for Friday Jul 12 ...
Publication Date: Friday Jul 12, 1996. Open House Listings. You can scroll through this list of openhouses or click on one of ...

UNFY: Historical Prices for Unify ...
Jul 12, 1996. 9.38. 9.38. 8.63. 8.88. 37,600. 22.19. Jul 11, 1996. 9.75. 10.25. 8.63. 8.88. 38,500. 22.19. Jul 10, 1996. 10.62 ...

Digest 1 of pEGFP-C2: 4735 bases ...
Fri, Jul 12, 1996. Page. AseI ... Fri, Jul 12, 1996. Page. EagI. Bgl II. XhoI ... Fri, Jul 12, 1996. Page. DrdI ...

ReaderWire
Publication Date: Friday Jul 12, 1996 ... Chimalus Drive, Palo Alto (by voice mail) Publication Date: Friday Jul 12, 1996 ...

Issue #335 | Magazine Archive | More ...
by Rebecca Ascher-Walsh | Jul 12, 1996 ... by Kate Meyers | Jul 12, 1996 ... Jul 12, 1996. Her debut CD ''Jenny McCarthy's ...

The Irish Times - Fri, Jul 12, 1996 ...
A chara I know something about Bord na Mona, having been for almost 40 years a member of the board and Chairman ...

The official Dilbert website with ...
The Official Dilbert Website featuring Scott Adams Dilbert strips, animation, mashups and more starring Dilbert, Dogbert, Wally, ...

Tambach, Germany - Jul 10, 1996 ...
Login or register to post comments. Photos. Be the first to upload a ticketstub or concert poster from this show! ...

WWW Statistics for www.uiowa.edu
... 373530398 43260 | Jul 10 1996 4.39 4.78 392895693 44221 | Jul 11 1996 3.75 4.03 331602609 37749 | Jul 12 1996 1.63 ...

Science/AAAS | Subject Index: 12 ...
Science Jul 12 1996: 157-0. | Summary " ... Science Jul 12 1996: 228-231. | Abstract " ... Science Jul 12 1996: 242-245. ...

The Irish Times - Fri, Jul 12, 1996 ...
... my comments on the murder of Veronica Guerin (June 28th) I attempted to declare that she was not murdered because ...

IN: Ketua PPBI Dita Sari Ditangkap
IN: Ketua PPBI Dita Sari Ditangkap. From: apakabar@clark.net. Date: Fri Jul 12 1996 - 10:37:00 EDT. From: John MacDougall ...

CCN Dialup Usage for Week Ending Jul ...
... 40 ++ *** ** +30 ++ * * ++ 20 ++ * * ++ +10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Auto sales fall 1.4 percent - Jul ...
NEW YORK (CNNfn) - In the latest retail sales report issued Friday, the Commerce Department reported auto sales ...

Presentations/Articles Archive 1996 ...
Skip to Navigation. NED. Presentations/Articles Archive. 1996. Jul 13, 1996. The Jews of Salonika: Breaking the Silence ...

Hamburg, Germany - Jul 13, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jul 13, 1996. Hamburg, Germany. Bahrenfeld-Trabrennbahn. Average: 0. what is this? ...

Organizations Registry (r)
Organizations Registry (r) From: apakabar@clark.net. Date: Sat Jul 13 1996 - 08:30:00 EDT. From: John MacDougall <apakabar ...

Daily Transmission Statistics
... 1996 3.13 3.09 900,216,114 101,044 | Jul 12 1996 2.18 2.36 687,973,985 70,379 | Jul 13 1996 2.11 2.37 691,241,524 ...

tc-list : Message: Mk 15:45
Check them out and nominate your group. ... mirkova1@...,edu. Sat Jul 13, 1996 6:47 am ... Jul 13, 1996. 10:53 am. Re: Mk 15:45 ...

Issues: Foreign Policy (r)
Issues: Foreign Policy (r) From: apakabar@clark.net. Date: Sat Jul 13 1996 - 15:53:00 EDT. From: John MacDougall <apakabar ...

Theatre of Dreams FTP Application
65540 Jul 19 1997 10score.jpg. 7629 Mar 16 21:22 140398.gif. 15592 Nov 25 1996 16midd.jpg. 1041 Mar 16 0:06 2.GIF ...

Alpine gems - The Irish Times - Sat ...
IF YOU were a fly on the wall of George and Rose Sevastopulo's Howth garden - or even a greenfly on a bud - you'd see that George ...

CCN Dialup Usage for Week Ending Jul ...
... 40 ++ *** ** +30 ++ * * ++ 20 ++ * * ++ +10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

COATED CUTTING EDGES - Google Patent ...
Filing date: Apr 24, 1969. Issue date: Apr 1971. Inventor: Carl W. Schweiger. Assignee: Dow Corning Corporation. Read this patent ...

Carolyn's Diary
Apartment hunting breeds fear in me so strong. I am pair bonded to having a permanent address, a phone number, citizenship status. ...

Golchin II (Persian) Page 1 of 5
This is an auto-framed archive page last updated Jul 13, 1996. You may find outdated advertising or navigation information. ...

Dole paints a different economic ...
WASHINGTON (CNNfn) - With the lowest unemployment rate in six years, an economy that's growing and inflation under ...

WWW Statistics for www.uiowa.edu
... 1.57 129458916 16411 | Jul 13 1996 1.75 1.93 158766949 17593 | Jul 14 1996 4.13 4.15 341670500 41590 | Jul 15 1996 ...

NBC and the 1996 Olympics (by Ariel ...
Jul 14, 1996 Olympic futbol on US TV? It is unpatriotic. ( Ariel Mazzarelli) Jul 23, 1996 Frothing at the mouth ...

Jul 14, 1996 - Sunday Mirror ...
Articles in Jul 14, 1996 issue of Sunday Mirror. Sunday edition of Britain's tabloid newspaper features articles on ...

Cottbus, Germany - Jul 14, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jul 14, 1996. Cottbus, Germany. Stadthalle. Average: 0. what is this? Tracks ...

CCN Dialup Usage for Week Ending Jul ...
... 40 ++ *** * ++30 ++ * * ++ 20 ++ * * ++ +10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Ozone Hole Image for July 13, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. July 13, 1996. Jul. 12, 1996 · Jul. 14, 1996 ...

Toronto - 7/14/96
From: Mike C. Pawlik. Eden Music Fest. Jul 14, 1996. Toronto, ONT. went to eden fest this past weekend to catch the ...

WWW Statistics for www.uiowa.edu
... 129458916 16411 | Jul 13 1996 1.75 1.93 158766949 17593 | Jul 14 1996 4.13 4.15 341670500 41590 | Jul 15 1996 4.34 ...

Onion Valley - Climber.Org Trip Report
On Saturday I met my father for a brief jaunt up Independence Peak. At 11,742, this is the lowest peak in the region; ...

July 14, 1996 San Francisco Giants ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Jul 14, 1996, Giants at Dodgers Box Score and Play by Play ...

Ozone Hole Image for July 15, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. July 15, 1996. Jul. 14, 1996 · Jul. 16, 1996 ...

uncompressed (9,131,620bytes)
... RAPID 0.1-PAIR G570H 943 T 1390 6029 Y2Q6A201T Jul 14 1995 2:21PM Jul 14 1996 6:42PM SATURN-RING 00 00 00.15 -00 ...

World-Wide Web Access Statistics for ...
... 115300124 27018 | Jul 12 1996 1.10 1.15 46346280 12171 | Jul 14 1996 4.61 4.53 182807483 51047 | Jul 15 1996 3.25 ...

GeoNet – alert bulletin: Jul 14 1996 ...
alert bulletin: Jul 14 1996, 9:30 am - Ruapehu Volcano. Science Alert Bulletin RUA-96/37 - Update. Although seismicity ...

[TXT] ew7-15-96.html
JERUSALEM (Jul 14, 1996 6:29 p.m. EDT) -- Israel's ... TEL AVIV (Jul 14, 1996 6:29 p.m. EDT) - Hardline Prime Minister ...

IN/POL: TIRAS - Buyung: Saya Jangan
IN/POL: TIRAS - Buyung: Saya Jangan. From: apakabar@clark.net. Date: Sun Jul 14 1996 - 07:26:00 EDT. From: John MacDougall ...

Letters, Jul. 15, 1996 - TIME
Letters, Jul. 15, 1996. Monday, Jul. 15, 1996 ... Your report proves that religion is good for your health. Spirituality is a ...

Notebook: Jul. 15, 1996 - TIME
... MARONEY, JODIE MORSE, AINISSA RAMIREZ AND ALAIN L. SANDERS Monday, Jul. 15, 1996 ... truck driver Driving along Route 50 ...

News Releases - Government of ...
Jul. 15, 1996 - CROP DEVELOPMENT REMAINS BEHIND NORMAL. Jul. 15, 1996 - SASKENERGY INTERNATIONAL TO MARKET ... Jul. 15, 1996 - NON ...

MSNBC network launches - Jul. 15, 1996
NEW YORK (CNNfn) - Microsoft and NBC on Monday launched MSNBC, the biggest start-up in cable television history. ...

The New Yorker Digital Edition : Jul ...
The New Yorker : Jul 15, 1996. Contents. Comment. Cartoon. The Talk of the Town. The Talk of the Town. The Talk of the Town ...

A Life Eclipsed : Jul 15, 1996 ...
... years, 1,915 covers and 49,833 stories from PEOPLE magazine's history for you to enjoy. Jul 15, 1996 Vol. 46 No. 3 ...

Grasshoppers - FC Zuerich (Jul 15, 1996)
Grasshoppers - FC Zürich (Jul 15, 1996) Under ideal conditions, in front of a decent 12'000 spectators, a far less ...

Ship shapes - The Irish Times - Mon ...
SOMETIMES it's not possible - nor even necessary - to be a fashion original. That's why the classic combination of ...

PEOPLE - The Irish Times - Mon, Jul ...
FILM star Gregory Peck was in a stable condition yesterday, following emergency surgery for a suspected intestinal ailment shortly ...

IN: TASS - Aksi Puasa ...
IN: TASS - Aksi Puasa ... From: apakabar@clark.net. Date: Mon Jul 15 1996 - 18:03:00 EDT. From: John MacDougall <apakabar@clark.net> ...

KansasFest Guest Book
posted by www.woz.org on Mon, Jul 15, 1996 11:43 AM: ... posted by www.woz.org on Mon, Jul 15, 1996 5:54 PM: ...

IN: Pak Gito ttg Demo Buruh Surabay
IN: Pak Gito ttg Demo Buruh Surabay. From: apakabar@clark.net. Date: Mon Jul 15 1996 - 18:04:00 EDT. From: John MacDougall ...

World-Wide Web Access Statistics for ...
Totals for Summary Period: Jul 8 1996 to Jul 15 1996 ... 29841934 3623 | Jul 14 1996 3.41 3.38 11890323 1401 | Jul 15 1996 ...

FYI France ejournal Jul 15, 1996
Jul 15, 1996 issue. This file presents an archive copy of the issue of the FYI France ejournal, ... From kessler Jul 15 1996 ...

RPFRX: Historical Prices for DAVIS ...
Jul 15, 1996. 16.83. 16.83. 16.83. 16.83. 0. 6.65. Jul 12, 1996. 16.95. 16.95. 16.95. 16.95. 0. 6.69. Jul 11, 1996. 16.97 ...

Helms Burton delayed - Jul. 16, 1996
WASHINGTON--(CNNfn) President Clinton announced a compromise Tuesday allowing a plan imposing legal sanctions on ...

News Releases - Government of ...
Jul. 16, 1996 - HEALTH LABOUR RELATIONS COMMISSIONER APPOINTED ... Jul. 16, 1996 - MOOSE JAW REGIONAL ECONOMIC DEVELOPMENT ...

Lowering the tech risk - Jul. 16, 1996
NEW YORK (CNNfn) - If you are enticed by the technology sector's high returns but frightened of its volatility, you ...

Path Study• News Release, Jul. 16, 1996
... Study• News Release, Jul. 16, 1996. California Department of ... [w] (916) 327-1636. q. John Coburn, State Water Contractors ...

RPFRX: Historical Prices for DAVIS ...
Jul 16, 1996. 16.76. 16.76. 16.76. 16.76. 0. 6.62. Jul 15, 1996. 16.83. 16.83. 16.83. 16.83. 0. 6.65. Jul 12, 1996. 16.95 ...

Arts & Culture Corner (r)
Date: Tue Jul 16 1996 - 13:19:00 EDT. From: John ... Written 3:01 AM Jul 16, 1996 by web:cnrmcan in igc:reg.indonesia ...

Poster
NonFamily Abduction. TRISTEN MYERS. DOB: Jul 16, 1996. Missing: Oct 5, 2000. Age Now: 14. Sex: Male. Race: White. Hair: Blonde ...

The official Dilbert website with ...
Jul 22, 1996. 13 Votes. 1 Comments. 4.17. Jul 16, 1996. 18 Votes. 3 Comments. 4.1. Jul 15, 1996. 23 Votes. 2 Comments. No ...

Official Gazette Notices for 1996
Week29 - Jul 16, 1996. Week30 - Jul 23, 1996. Week31 - Jul 30, 1996. Week32 - Aug 5, 1996. Week33 - Aug 13, 1996 ...

Daily Transmission Statistics
... 14 1996 3.86 3.65 1,063,508,097 124,913 | Jul 15 1996 3.46 3.14 916,486,868 111,981 | Jul 16 1996 3.46 3.10 902, ...

Jul-16-1996 - NOFX Wiki
Jul-16-1996. Gig Information. Date: Jul-16-1996. City: Bonner Springs, KS ... Retrieved from "http://nofxwiki.net/w/Jul-16-1996" ...

GAME APPARATUS COMPRISING FINGER ...
Jul 16, 1996. Drawings. Drawing. Google Home - About Google - About Google Patents - Google Patents Help ©2010 Google ...

CCN Dialup Usage for Week Ending Jul ...
... 40 ++ ** ++ | 30 ++ * * ++ 20 ++ * ** ++ 10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

eightfold-l : Messages : 897-926 of 3687
Jul 16, 1996. 5:25 am. 903. Right View. When One's Knowledge is Truly One's Own [Kaccayana:] "Lord, 'Right view, right ...

Happy Gilmore (VHS, 1996) - eBay ...
Jul 16, 1996. Director: Dennis Dugan. UPC: 096898282031. Format: NTSC (US, Canada) Genre: Comedy. See reviews. Detailed item info ...

Expert Opinion - Jul. 17, 1996
Here are responses to some of the first questions to Robert Hormats, vice chairman of Goldman Sachs. "What is your ...

tc-list : Messages : 800-829 of 8488
Jul 17, 1996. 8:50 pm. 810. Mk 15:45. Thank you Vincent for clarifying some points in my question. Part of the ...

Justice, Nasdaq settle - Jul. 17, 1996
WASHINGTON (CNNfn) - The Justice Department and the Nasdaq stock exchange have settled a price collusion investigation ...

K's Legobrot: 3D Lego Fractals
Homepage of Conrad Parker ... Legobrot creates a file containing LegoPS commands to build the fractal model. ...

Stanford Theatre Schedule for ...
Publication Date: Wednesday Jul 17, 1996. Stanford Theatre Schedule <*C>Playing Wednesday and Thursday: The Freshman ...

Art Information - Jul. 26, 1996
In the art laboratory in which I am participating as a curator, I have been continuing the collaborative work with ...

SSIAX: Historical Prices for LEGG ...
Jul 17, 1996. 18.49. 18.49. 18.49. 18.49. 0. 7.23. Jul 16, 1996. 18.41. 18.41. 18.41. 18.41. 0. 7.20. Jul 15, 1996. 18.46 ...

GovTrack: Senate Vote #194 (Jul 17, 1996)
A vote in the U.S. Congress. ... On the Motion to Table (motion to table simon amdt no. 4591 ) ... Jul 17, 1996 12:58PM. Result: ...

RPFRX: Historical Prices for DAVIS ...
Jul 17, 1996. 16.82. 16.82. 16.82. 16.82. 0. 6.64. Jul 16, 1996. 16.76. 16.76. 16.76. 16.76. 0. 6.62. Jul 15, 1996. 16.83 ...

The 1996 Olympics (by Ariel ...
Jul 17, 1996 This won't hurt, believe me Jul 20, 1996 Turn out the lights, the Dream Team is losing Jul 20, 1996 ...

The Code of Federal Regulations
This document is sponsored by the Office of the Federal Register, National Archives and Records Administration on ...

outlookindia.com - Contents - July ...
Contents | MAGAZINE | Jul 17, 1996 ... Jul 17, 1996. Regulars. London Diary ... The page 3 people, the chatterati and those ...

FRB: H.4.1 Release-- Factors ...
Jul 17, 1996. Jul 10, 1996 ... Jul 17, 1996. Reserve Bank credit 1 2. 425,234 ... Jul 17, 1996. Wednesday. Jul 10, 1996. Wednesday ...

New surface for rough private street
@credit:Joe Melena Publication Date: Wednesday Jul 17, 1996. New surface for rough private street. San Carlos Court ...

CCN Dialup Usage for Week Ending Jul ...
... 50 ++ * * ++ 40 ++ * * ++ |30 ++ * * ++ +20 ++-*0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

News Releases - Government of ...
Jul. 18, 1996 - BIG GAME DAMAGE COMPENSATION PROGRAM INTRODUCED ... Jul. 18, 1996 - BORDER REGIONAL ECONOMIC DEVELOPMENT ...

More "Expert Opinions" by Robert ...
NEW YORK (CNNfn) - On CNNfn's "Expert Opinion" site you send in your questions and top analysts and experts will answer you. ...

Chicago Reader | Issue Archives ...
Comprehensive guide to Chicago ... Entrepreneur John Phillips has publishing giant R.R. Donnelley by the short hairs, and ...

Investors running scared - Jul. 18, 1996
NEW YORK (CNNfn) - If Wall Street ever had a "Maalox Moment," it certainly came this week as a volatile stock market ...

GovTrack: Senate Vote #203 (Jul 18, 1996)
A vote ... Participate in our Citizen Reporter Contest: Win $500 for a camera-phone interview with ... Jul 18, 1996 5:41PM ...

Poster
Unidentified Child. NO NAME. DOB: Found: Jul 18, 1996. Height: 48 cm (1'7") Eyes: Brown. Race: White/Hisp. Age Now: 0. Sex: Male ...

Oslo, Norway - Jul 18, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jul 18, 1996. Oslo, Norway. Spektrum. Average: 3. Average: 3 (1 vote) what is this? ...

Digest 1 of pYEX4T-2: 7850 bases ...
Thu, Jul 18, 1996 ... Jul 18, 1996 ... Thu, Jul 18, 1996. Page. Bst1107 I ...

Digest 1 of pYEX-S1: 8356 bases ...
Thu, Jul 18, 1996. Page. HpaI. Eco47 III ... Thu, Jul 18, 1996. Page ... Thu, Jul 18, 1996. Page. Bst1107 I. Ppu10 I. NsiI ...

Kusachi Fumie Information center - Ryu1
Japanese. since Jul.18, 1996. Kusachi Fumie Information Center. Welcom to Kusachi Fumie Web site. photo gallery. product. Voice ...

News Release Archive 1996
Jul. 18, 1996. Scientists Identify Genes Critical to Transmission of Bubonic Plague. Jul. 11, 1996. NIAID-Supported ...

SSIAX: Historical Prices for LEGG ...
Jul 18, 1996. 18.65. 18.65. 18.65. 18.65. 0. 7.29. Jul 17, 1996. 18.49. 18.49. 18.49. 18.49. 0. 7.23. Jul 16, 1996. 18.41 ...

UNFY: Historical Prices for Unify ...
Jul 18, 1996. 8.13. 9.63. 8.13. 9.25. 38,700. 23.13. Jul 17, 1996. 8.25. 8.25. 7.75. 8.13. 40,800. 20.31. Jul 16, 1996. 8.63 ...

[TXT] es7-18-96.html
VATICAN CITY, JUL 18, 1996 (VIS) - Cardinal Secretary ... VATICAN CITY, JUL 18, 1996 (VIS) - The Synod of Bishops was created ...

CCN Dialup Usage for Week Ending Jul ...
... 40 ++ * ** ++ 30 ++ * * ++ 20 ++ * ** ++ 10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

People: Jul. 29, 1996 - TIME
His shaky health has curtailed his once half-day walks, but he still manages to get around. Since a Pontiff's work ...

ReaderWire
... Date: Friday Jul 19, 1996. ReaderWire. Publication Date: ... I don't really know the legal difference between sidewalk sitting and ...

News Releases - Government of ...
Jul. 19, 1996 - JILIN TWINNING ... Jul. 19, 1996 - OIL AND GAS ACTIVITY STRONG FOR FIRST HALF OF 1996. Jul. 19, 1996 - LINGENFELTER ...

ArctanX's HomePage / not ActiveX!
This is my welcome page. ... You are 83180 th visitor since Jul 24, 1996. You have new mail. ( Update:11:34:31 JST Apr 25 2004) ...

RPFRX: Historical Prices for DAVIS ...
Jul 19, 1996. 17.05. 17.05. 17.05. 17.05. 0. 6.73. Jul 18, 1996. 17.02. 17.02. 17.02. 17.02. 0. 6.72. Jul 17, 1996. 16.82 ...

Column - Aug. 20, 1996
The project by Ocean Earth suggesting effective usage of ocean resources and rivers. (The Genova Bay and a nearby river) ...

CFJ ARCHIVE (221-235)
A retracted proposal can fail due to quorum, and then penalties according to rule 207, 3rd paragraph shall be distributed. ...

Milestones Jul. 1, 1996 - TIME
G. DAVID SCHINE, 68, the Joseph McCarthy aide whose controversial Army stint led to the historic 1954 Army-McCarthy ...

info-cvs : Messages : 2026-2055 of 26776
info-cvs: installing and using CVS ... See how Yahoo! Groups impacts members worldwide. Best of Y! Groups. Check them out and ...

Kiddin' around
Publication Date: Friday Jul 19, 1996. Kiddin' around. For many young ones, the good times at this weekend's Connoisseur's ...

SSIAX: Historical Prices for LEGG ...
Jul 19, 1996. 18.59. 18.59. 18.59. 18.59. 0. 7.27. Jul 18, 1996. 18.65. 18.65. 18.65. 18.65. 0. 7.29. Jul 17, 1996. 18.49 ...

Time-TBS deal near close - Jul. 19, 1996
WASHINGTON (CNNfn) - The creation of the world's largest media and entertainment conglomerate moved a step closer ...

Art Information - Aug. 6, 1996
"Art is Fun 7 IN/OUT" From July 6 to September 1, 1996 Held At Hara Museum ARC. 2844 Kanai Shibukawa-shi, Gunma prefecture ...

GovTrack: House Vote #293 (Jul 10, 1996)
... agree: H CON RES 193 Expressing Sense of Congress Regarding Reductions in Government Spending and Regulatory Programs ...

Math Forum Discussions - User ...
Jul 19, 1996 11:04 PM. 7 ... Jul 19, 1996 10:53 PM. 10 ... Jul 19, 1996 10:51 PM. Show all user messages [Privacy ...

CNN - Azerbaijan leader purges ...
BAKU, Azerbaijan (CNN) -- In a live broadcast on state television, Azerbaijan President Haydar Aliyev has fired ...

The 1996 Olympics (by Ariel ...
Jul 17, 1996 This won't hurt, believe me Jul 20, 1996 Turn out the lights, the Dream Team is losing Jul 20, 1996 Goodbye ...

WORLD Magazine | Today's News ...
Jul. 20, 1996. Arkansas' Mister Clean. Jul. 6, 1996. Future of health care. Jun. 22, 1996. Disorder in the Court. Jun. 8, 1996 ...

Picasa Web Albums - Troy
You are using a browser that is not fully ... Jul 20, 1996. Photos: 257 ... Jul 20, 1996. Photos: 20. KDI 1995. Jul 20, 1995 ...

WORLD Magazine | Quotables | | Jul ...
Renewables like solar power and others can't fuel America's future. FULL STORY. Table of Contents View E-zine Archives ...

IN/ET: Whose Integration? #2
IN/ET: Whose Integration? # 2. From: apakabar@clark.net. Date: Sat Jul 20 1996 - 11:24:00 EDT. From: John MacDougall <apakabar ...

NetWorld+Interop'96 Tokyo SSD IPv6 booth
Sat Jul 20 1996. We IPv6 team can make this gorgeous hotel room... into this cable-heaven situation, with less than 5 minutes ...

CNN - Mongolia's first democratic ...
... a democratic coalition for parliamentary elections in June, was elected prime minister by parliament on Friday. ...

Daily Transmission Statistics
... 621,203,763 65,166 | Jul 20 1996 2.20 2.31 672,776,693 71,010 | Jul 21 1996 3.58 3.52 1,025,665,068 115,812 | Jul ...

Numbers On The Site: 1996 Broken ...
1996 Broken Arrow European Tour ... Jul 20 1996, SECC, Glasgow, Scotland. Fuckin' Up ... Jul 20 1996. SECC, Glasgow, Scotland ...

The Irish Times - Sat, Jul 20, 1996 ...
In dark or critical days, there is always a danger of allowing the dark things to prevail and overcome our thoughts ...

The Irish Times - Sat, Jul 20, 1996 ...
WITH the opening on Thursday night of the very cool sounding Isobar, it's clear the vogue for hip looking cafe bars ...

Issues: Law & Liberty (r)
Issues: Law & Liberty (r) From: apakabar@clark.net. Date: Sat Jul 20 1996 - 10:57:00 EDT. From: John MacDougall <apakabar@clark.net> ...

xfer_960720.html
TOTALS FOR SUMMARY PERIOD Fri Jul 19 1996 TO Sat Jul 20 1996 ... 3.6 KB/s 99.61 99.34 Sat Jul 20 1996 64 20063421 4.7 KB/s ...

GeoNet – alert bulletin: Jul 20 1996 ...
alert bulletin: Jul 20 1996, 6:00 pm - Ruapehu Volcano. Science Alert Bulletin RUA-96/45 - Update. Sustained, moderate ...

Pori, Finland - Jul 21, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jul 21, 1996. Pori, Finland. Kirjurinluoto. Average: 0. what is this? Tracks ...

[TXT] es7-21-96.html
VATICAN CITY, JUL 21, 1996 (VIS) - This morning ... VATICAN CITY, JUL 21, 1996 (VIS) - Following today's noon angelus, the ...

Sermon Jul 21 1996
A Sermon by Ken Shillito - Winchelsea Jul 21 1996. Preaching Resources. Home. Winchelsea Church. Send me an email ...

CNN - Russian offensive enters ...
Bad weather hampered the operation Sunday, but a Russian spokesman said forces were preparing for a "large-scale ...

CNN - Relief aid reaches flooded ...
... southwest China received a break Sunday, as hundreds of tons of supplies, food and mineral water arrived in the region. ...

CCN Dialup Usage for Week Ending Jul ...
... 40 ++ * ** ++ 30 ++ * * ++ 20 ++ * ** ++ 10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Issues: Press (r)
Issues: Press (r) From: apakabar@clark.net. Date: Sun Jul 21 1996 - 16:21:00 EDT. From: John MacDougall <apakabar@clark.net> ...

TWU - TWU Libraries - 1996 TWU Update
Jul 8-Jul 21, 1996. Jun 24-Jul 7, 1996. Jun 10-Jun 23, 1996. May 27-Jun 9, 1996. May 13-May 26, 1996. May 6-May 12, 1996 ...

Daily Transmission Statistics
... 65,166 | Jul 20 1996 2.20 2.31 672,776,693 71,010 | Jul 21 1996 3.58 3.52 1,025,665,068 115,812 | Jul 22 1996 3.54 ...

Ozone Hole Image for July 22, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. July 22, 1996. Jul. 21, 1996 · Jul. 23, 1996 ...

Ozone Hole Image for July 20, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. July 20, 1996. Jul. 19, 1996 · Jul. 21, 1996 ...

The official Dilbert website with ...
Aug 5, 1996. 32 Votes. 2 Comments. 4.17. Jul 21, 1996. 21 Votes. 5 Comments. 4.33. May 10, 1996. 63 Votes. 3 Comments. No ...

GeoNet – alert bulletin: Jul 21 1996 ...
alert bulletin: Jul 21 1996, 11:30 am - Ruapehu Volcano. Science Alert Bulletin RUA-96/46 - Update. Sustained, moderate ...

e-may.htm
(Photo:Jul/21/1996) (Photo:Jul/28/1996) (Photo:Apr/11/2002) (Photo:May/3/2002) (Photo:May/11/2003) (Photo:May/12/2003) ...

Meetings & Performances (r)
Meetings & Performances (r) From: Johan_Sulaiman@wmg.com. Date: Sun Jul 21 1996 - 22:07:00 EDT. Original Text. From ...

Letters, Jul. 22, 1996 - TIME
Letters, Jul. 22, 1996. Monday, Jul. 22, 1996 ... such strong women as Hillary Rodham Clinton and Elizabeth Hanford Dole are ...

Notebook: Jul. 22, 1996 - TIME
... L. SANDERS AND ERIC SILVER Monday, Jul. 22, 1996 ... American Urological Association meeting BAD NEWS: American Journal ...

Prudential starts payback - Jul. 22 ...
NEW YORK (CNNfn) -- Think you've been paying too much for life insurance? You may be right -- particularly if you ...

News Releases - Government of ...
Jul. 22, 1996 - 1996 CROP CONTINUES TO DEVELOP BEHIND NORMAL ... Jul. 22, 1996 - SASKATCHEWAN CROP INSURANCE IMPLEMENTS TOLL ...

Microsoft focuses on Web - Jul. 22, 1996
... Wide Web with its Windows 95 operating system, a move that would bring revolutionary change to personal computing. ...

Daily Transmission Statistics
... 65,166 | Jul 20 1996 2.20 2.31 672,776,693 71,010 | Jul 21 1996 3.58 3.52 1,025,665,068 115,812 | Jul 22 1996 3.54 ...

The New Yorker Digital Edition : Jul ...
The New Yorker : Jul 22, 1996. Contents. Centennial. Cartoon. The Talk of the Town. The Talk of the Town. The Talk of the Town ...

UNFY: Historical Prices for Unify ...
Jul 22, 1996. 9.00. 9.25. 8.37. 8.75. 10,900. 21.87. Jul 19, 1996. 9.75. 9.75. 9.00. 9.00. 10,100. 22.50. Jul 18, 1996. 8.13 ...

July 22, 1996 Minnesota Twins at ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Jul 22, 1996, Twins at Orioles Box Score and Play by Play ...

World-Wide Web Access Statistics for ...
Totals for Summary Period: Jul 15 1996 to Jul 22 1996 ... 38074731 4399 | Jul 21 1996 3.47 3.42 10847757 1279 | Jul 22 1996 ...

The official Dilbert website with ...
Jul 22, 1996. 13 Votes. 1 Comments. 4.17. Jul 16, 1996. 18 Votes. 3 Comments. 4.1. Jul 15, 1996. 23 Votes. 2 Comments. No ...

CCN Dialup Usage for Week Ending Jul ...
... 40 ++ *** ** +30 ++ * * ++ 20 ++ * ** ++ 10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Ozone Hole Image for July 23, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. July 23, 1996. Jul. 22, 1996 · Jul. 24, 1996 ...

[TXT] ew7-22-96.html
GROZNY, Russia (Jul 22, 1996 0:29 a.m. EDT) -- Russian troops pressed ahead Sunday with an attack on a rebel base ...

SN 1996al.
DISCOVERED ON. Jul. 22, 1996. R.A. ( 2000.0) ... 6437 Jul. 22, 1996. HUBBLE TYPE. SBc. REFERENCES. Discovered by R.Evans, R. ...

DeRose's "Expert Opinion" - Jul. 23 ...
NEW YORK (CNNfn) - This week's "Expert Opinion" comes from Computer software analyst Gene DeRose of Jupiter Communications. ...

News Releases - Government of ...
Jul. 23, 1996 - UPSHALL TO WORK AGAINST MOTION FROM ALBERTA ON CWB. Jul. 23, 1996 - PUBLIC ... Jul. 23, 1996 - DOUBLE DIGIT INCREASE ...

Getting Congress Wired - Jul. 23, 1996
New York (CNNfn) - The rise of the Internet is an old story by now. But while much of the world is becoming wired, ...

CNN - World Briefs - Jul. 23, 1996
JAKARTA, Indonesia (CNN) -- The United States and Russia agreed Tuesday to approve a nuclear test ban treaty's draft, ...

NBC and the 1996 Olympics (by Ariel ...
( Ariel Mazzarelli) Jul 23, 1996 Frothing at the mouth over ... Mazzarelli) Jul 23, 1996 This one will not be among GE/NBC up ...

GovTrack: Senate Vote #224 (Jul 23, 1996)
On the Motion to Table the Motion to Reconsider (motion to table motion ... Jul 23, 1996 2:45PM. Result: Motion to Table ...

Copenhagen, Denmark - Jul 23, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jul 23, 1996. Copenhagen, Denmark. Den Grå Hal. Average: 0. what is this? ...

CCN Dialup Usage for Week Ending Jul ...
... 40 ++ *** ** +30 ++ * * ++ 20 ++ * * ++ +10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Daily Transmission Statistics
... 3.54 3.34 972,824,911 114,568 | Jul 23 1996 4.42 4.29 1,251,033,252 142,905 | Jul 24 1996 4.09 3.96 1,156,201,883 ...

DESIGN FOR A FAN - Google Patent Search
Jul 23, 1996. D373015. Folding sweep sport fan. Aug 27, 1996. Drawings. Drawing. Google Home - About Google - About ...

U.S. women take home gymnastics gold ...
On July 23, 1996, at the Summer Olympics in Atlanta, Georgia, the U.S. women's gymnastics team wins its ... Jul 23, 1996: ...

Ozone Hole Image for July 22, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. July 22, 1996. Jul. 21, 1996 · Jul. 23, 1996 ...

Ozone Hole Image for July 24, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. July 24, 1996. Jul. 23, 1996 · Jul. 25, 1996 ...

Way Out There by Exodus Quartet on ...
Jul 23 1996. Overview Edit ... Jul 23 1996. 1 other version of this release ... release dates: Jul 23 1996. view details ...

UNFY: Historical Prices for Unify ...
Jul 23, 1996. 8.37. 8.50. 8.25. 8.50. 8,200. 21.25. Jul 22, 1996. 9.00. 9.25. 8.37. 8.75. 10,900. 21.87. Jul 19, 1996. 9.75 ...

News Releases - Government of ...
Jul. 24, 1996 - SUMMER STORM COSTS. Jul. 24, 1996 - WHELAN AND KAISER ... Jul. 24, 1996 - CCTA REVIEW TO BE COMPLETED BY NOVEMBER ...

Trade legislation outrages business ...
WASHINGTON (CNNfn) - Just one week after a controversy erupted between the United States and Cuba, President Clinton ...

UAW might target GM - Jul. 24, 1996
... talks later this year, believing the nation's largest automaker was weakened in is resolve by a strike earlier this year. ...

Stanford Theatre Schedule for ...
Publication Date: Wednesday Jul 24, 1996. Stanford Theatre Schedule <*C>Playing Wednesday and Thursday: The Bright ...

cvs
... helps to tag the branchpoint (you may need that later) Time: 19:38:11 Date: Wed Jul 24 1996 Host: all-purpose ...

Copenhagen, Denmark - Jul 24, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jul 24, 1996. Copenhagen, Denmark. Den Grå Hal. Average: 0. what is this? ...

ArctanX's HomePage / not ActiveX!
You are 83180 th visitor since Jul 24, 1996. You have new mail. ( Update:11:34:31 JST Apr 25 2004) Profile (Update: ...

Münster, Germany Münster - Jul 1 ...
Tracks (Click song title for lyrics) Drifter's Escape. Shake Sugaree. All Along The Watchtower. Simple Twist Of Fate ...

SSIAX: Historical Prices for LEGG ...
Jul 24, 1996. 18.42. 18.42. 18.42. 18.42. 0. 7.20. Jul 23, 1996. 18.45. 18.45. 18.45. 18.45. 0. 7.21. Jul 22, 1996. 18.49 ...

outlookindia.com - Contents - July ...
Contents | MAGAZINE | Jul 24, 1996 ... Jul 24, 1996. Regulars. Madras Diary ... The page 3 people, the chatterati and those ...

Picasa Web Albums - Debajyoti Majumdar
8 albums ... We're doing maintenance, but things should be back to normal soon. Our Visit to Sun Temple & Puri. Oct 7, 2009 ...

RPFRX: Historical Prices for DAVIS ...
Jul 24, 1996. 16.83. 16.83. 16.83. 16.83. 0. 6.65. Jul 23, 1996. 16.94. 16.94. 16.94. 16.94. 0. 6.69. Jul 22, 1996. 16.95 ...

FRB: H.4.1 Release-- Factors ...
... since * Wednesday Wednesday Wednesday Jul 24, 1996 Jul 17, 1996 Jul 26, 1995 -ASSETS Gold certificate account 11, ...

News Release Archive 1996
July 1996. Jul. 24, 1996. New Concept to Improve Live-Attenuated HIV Vaccines. Jul. 18, 1996. Scientists Identify ...

FRB: H.4.1 Release-- Factors ...
Jul 24, 1996. Jul 17, 1996 ... Jul 24, 1996. Reserve Bank credit 1 2. 419,281 ... Jul 24, 1996. Wednesday. Jul 17, 1996. Wednesday ...

Malmö, Sweden - Jul 25, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jul 25, 1996. Malmö, Sweden. Slottsmöllan. Average: 4.5. Average: 4.5 (2 votes) what is ...

Chicago Reader | Issue Archives ...
Comprehensive guide to Chicago ... Squeezed between the orange juice and a display of warm pork rinds, Congressman Luis ...

Thrifts talk $1.15b deal - Jul. 25, 1996
NEW YORK (CNNfn) -- First Nationwide Bank FSB is reportedly in talks to acquire Cal Fed Bancorp in a stock transaction ...

Internet firms troll for cash - Jul ...
Until last month, they were the darlings of Wall Street, but since then they've fallen on hard times. That hasn't ...

BioWorld Today - Jul 25, 1996
Advanced Search. Home : BioWorld Today : BioWorld Today Archives : July 1996 : Jul 25, 1996 ... Issue Contents: Jul 25, 1996 ...

UNFY: Historical Prices for Unify ...
Jul 25, 1996. 8.13. 8.50. 7.75. 8.50. 50,000. 21.25. Jul 24, 1996. 8.00. 8.37. 8.00. 8.00. 14,700. 20.00. Jul 23, 1996. 8.37 ...

SSIAX: Historical Prices for LEGG ...
Jul 25, 1996. 18.50. 18.50. 18.50. 18.50. 0. 7.23. Jul 24, 1996. 18.42. 18.42. 18.42. 18.42. 0. 7.20. Jul 23, 1996. 18.45 ...

Daily Transmission Statistics
132,329 | Jul 25 1996 4.18 4.22 1,229,537,474 135,027 | Jul 26 1996 2.53 2.75 801,765,793 81,865 | Jul 27 1996 2.47 ...

Ozone Hole Image for July 24, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. July 24, 1996. Jul. 23, 1996 · Jul. 25, 1996 ...

Japan Magazine Headlines Backnumber 96-3
Jul. 25, 1996 issue. The foremer mayor of Komae city, who now stays in a temple, told that his crazy gamble was accompanied by ...

Poster
NonFamily Abduction. LUCY MEADOWS. DOB: Oct 1, 1992. Missing: Jul 25, 1996. Age Now: 17. Sex: Female. Race: Asian. Hair: Brown ...

World-Wide Web Access Statistics for ...
... Jul 25 1996 2.61 3.05 123144583 28868 | Jul 26 1996 1.80 1.95 78830037 19906 | Jul 27 1996 2.27 2.13 86209514 25096 ...

Ozone Hole Image for July 26, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. July 26, 1996. Jul. 25, 1996 · Jul. 27, 1996> ...

WWW Statistics for www.uiowa.edu
... Jul 23 1996 4.03 4.02 330901825 40530 | Jul 24 1996 3.91 3.64 299192987 39353 | Jul 25 1996 3.51 3.55 292098835 ...

World-Wide Web Access Statistics for ...
... 4.06 1685463 61 | Jul 25 1996 5.04 6.03 2504623 76 | Jul 26 1996 1.26 1.40 583534 19 | Jul 27 1996 0.66 0.67 277849 ...

Art Information - Jul. 26, 1996
Aug. 6, 1996. Art Infomation Index - Jul. 26, 1996. Seiko Mikami. Upgrading the "Molecular Informatics" Exhibition. Yukiko SHIKATA ...

Column - Jul. 26, 1996
Aug. 20, 1996. Column Index - Jul. 26, 1996. a) Experiencing the world of Saburo TESHIGAWARA - The KARAS Workshop. Takaaki KUMAKURA ...

GovTrack: House Vote #369 (Jul 26, 1996)
Motion to Instruct Conferees: H R 3448 Small Business Job Protection ... Jul 26, 1996 1:04PM. Result: Passed. Related Bill: ...

News Releases - Government of ...
Jul. 26, 1996 - WOMEN'S WORK TRAINING PROGRAM HELPS WOMEN ... Jul. 26, 1996 - SASKTEL ANNOUNCES NEW LONG DISTANCE SAVINGS ...

COMDTINST 5300.9B JUL 26 1996
JUL 26 1996. COMMANDANT INSTRUCTION 5300.9B ... JUL 26 1996. 4. DISCUSSION. ... JUL 26 1996. g. Description of SEFQM Duties. ...

Strong Dow inspires market - Jul. 26 ...
... higher at midday Friday, strengthened by Thursday's gains and some positive developments in the semiconductor arena. ...

Stable funds hold answers - Jul. 26 ...
NEW YORK (CNNfn) -- For the feint of heart, the last two months haven't exactly been easy on Wall Street. After ...

Stanford Theatre Schedule for Friday ...
Publication Date: Friday Jul 26, 1996. Stanford Theatre Schedule <*C>Playing through Tuesday: Laura (1944) A beautiful ...

NetWorld+Interop'96 Tokyo SSD IPv6 booth
Fri Jul 26 1996. This is SSD IPv6 team. ... into this cable-heaven situation, with less than 5 minutes of time! ... Fri Jul 26 1996 ...

Ozone Hole Image for July 26, 1996
Daily ozone hole image for July 26, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

CanLII - Printing Services Act ...
1. since Jul 26, 1996 (current) ... Noteup any citation to this statute ... Current version: in force since Jul 26, 1996 ...

Openhouse listing for Friday Jul 26 ...
Publication Date: Friday Jul 26, 1996. Open House Listings. You can scroll through this list of openhouses or click on one of ...

IN/POL: VOA - PDI Free Speech Forum
IN/POL: VOA - PDI Free Speech Forum. From: apakabar@clark.net. Date: Fri Jul 26 1996 - 18:09:00 EDT. From: John MacDougall ...

CNN - Another public relations aide ...
LONDON (CNN) -- For six months Jane Aitkinson tried to raise the already stratospheric profile of the world's most ...

Science/AAAS | Subject Index: 26 ...
Science Jul 26 1996: 405-0. | Summary " ... Science Jul 26 1996: 475-480. | Abstract " ... Science Jul 26 1996: 480-483. ...

CNN - Sights and Sounds - Jul. 27, 1996
You said it... © 1996 Cable News Network, Inc. All Rights Reserved. Terms under which this service is provided to you. ...

ALS Storage Ring Beam History
Jul 27 1996. Jul 28 1996. Jul 29 1996. Jul 30 1996. Jul 31 1996. Return to Beam History Index. Home | News | Science ...

Stockholm, Sweden - Jul 27, 1996 ...
<PREV DATE CURRENT ARCHIVE NEXT DATE>> Jul 27, 1996. Stockholm, Sweden. Lida Friluftsgård. Average: 0. what is this? ...

WWW Access Statistics for the ...
Totals for Summary Period: Jul 27 1996 to Jul 20 1996 ... 1.47 1.33 9582401 585 | Jul 27 1996 14.34 15.51 111491777 5713 ...

Ozone Hole Image for July 27, 1996
Daily ozone hole image for July 27, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

Headlines Archive: 1996
NASA Funds Investigation Remote Sensing Commercialization. Nov 18, 1996: Creative Thinking May Help Retire Old Landfill Problem ...

News Release Archive 1996
News Releases and Statements For 1996. December 1996. Dec. 11, 1996. Fauci: New Findings on Host Factors Illuminate AIDS ...

Picasa Web Albums - Phil
33 albums ... Some features may not work too well, but you are welcome to have a look around. Explore. Phil's Gallery. Problems? ...

Issues: Law & Liberty (r)
Issues: Law & Liberty (r) From: apakabar@clark.net. Date: Sat Jul 27 1996 - 13:14:00 EDT. From: John MacDougall <apakabar@clark.net> ...

A Boy Called Hate | | EW.com
If awards were given for being almost funny, this offering (which, believe it or not, played theaters) would rake in the ...

Ozone Hole Image for July 26, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. July 26, 1996. Jul. 25, 1996 · Jul. 27, 1996> ...

CCN Dialup Usage for Week Ending Jul ...
... 40 ++ *** * ++30 ++ * * ++ 20 ++ * * ++ +10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Systems/Services | Media Relations ...
Seamless Data Base Access Facilitated By Integrated InterServ3 Web Server and InterServ Business-object Series. August 1996 ...

Electronic memory game housing ...
Filing date: Oct 14, 1980. Issue date: Apr 12, 1983. Inventor: Lap Lee. Assignee: Applied Industrial Company Limited ...

Picasa Web Albums - Schmakt
68 albums ... Some features may not work too well, but you are welcome to have a look around. Explore. Schmakt's Gallery. Problems? ...

CNN - Sights and Sounds - Jul. 28, 1996
Tell us what you think! You said it... © 1996 Cable News Network, Inc. All Rights Reserved. Terms under which this ...

News Releases - Government of ...
Jul. 30, 1996 - SIAST 1995 GRADUATE EMPLOYMENT STATISTICS REPORT RELEASED. Jul. 30, 1996 - BUFFALO POUND TROUT POND CLOSED ...

tc-list : Messages : 800-829 of 8488
Jul 28, 1996. 12:06 am. 814. Is 1:25. The MT here reads "kabor" (as lye) but the emendation "bkr" (in the furnace) has been ...

Fireworks At Sumida-gawa
Special Edition: Fireworks At Sumida-gawa (updated at: Jul 28, 1996) (Left) The street near the Sumida-gawa river is blocked. ...

CNN - Sci-Tech Newsreel - Jul. 28, 1996
FBI officials are using the Internet in their search for details about the crash of TWA Flight 800. Investigators ...

Issues: Law & Liberty (r)
Issues: Law & Liberty (r) From: apakabar@clark.net. Date: Sun Jul 28 1996 - 17:50:00 EDT. From: John MacDougall <apakabar@clark.net> ...

Ozone Hole Image for July 28, 1996
Daily ozone hole image for July 28, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

GovTrack: House Vote #369 (Jul 26, 1996)
A vote in the U.S. Congress. ... House Vote #369 (Jul 26, 1996) Motion to Instruct Conferees: H R 3448 Small Business Job ...

Picasa Web Albums - Phil
33 albums ... Some features may not work too well, but you are welcome to have a look around. Explore. Phil's Gallery. Problems? ...

e-oct.htm
(Photo:Jul/28/1996) (Photo:Oct/3/1996) Toad-Lily. It was named as "Hototogis" because the spot of flower look similar ...

Issues: Press (r)
Issues: Press (r) From: apakabar@clark.net. Date: Sun Jul 28 1996 - 10:52:00 EDT. From: John MacDougall <apakabar@clark.net> ...

News Releases in 1996 | NTT DATA
NTT DATA Releases Credit Card Authorization Software for Solaris Platform. Dec. 5, 1996 "CAFIS" formed "SET study ...

Jawbox by Jawbox on Atlantic / Wea ...
This record changed my life, and it sounds as good today as it did when I first heard it 9 years ago. It's twin ...

At North Farm by John Ashbery | The ...
Sunday. Jul. 28, 1996 "Prev. Next" E-mail. Share. Digg. del.icio.us. Facebook. At North Farm. by John Ashbery. SUNDAY 7/28 ...

Population News (Jul. 1, 1997)
A Statistical Look at Yokohama ... Households and population data have been estimated by adding the increase or subtracting ...

People: Jul. 29, 1996 - TIME
By Belinda Luscombe Monday, Jul. 29, 1996 ... Everybody needs a break occasionally, even the infallible. So when POPE JOHN ...

Notebook: Jul. 29, 1996 - TIME
... DAWNICA JACKSON, TYLER MARONEY, JODIE MORSE, JEFFERY C. RUBIN AND ALAIN L. SANDERS Monday, Jul. 29, 1996 ...

tc-list : Messages : 800-829 of 8488
tc-list: TC-List : Biblical Textual Criticism ... Want to share photos of your group with the world? Add a group photo to ...

News Releases - Government of ...
Jul. 29, 1996 - 1996 CROP SHOWS PROMISING YIELD PROSPECTS. Jul. 29, 1996 - PARTNERSHIP AGREEMENT ON FIRST NATIONS CURRICULUM ANNOUNCED ...

Stocks trading listlessly - Jul. 29 ...
NEW YORK (CNNfn) - Stocks hovered near the break-even point Monday as investors held back in advance of a batch ...

RPFRX: Historical Prices for DAVIS ...
Jul 29, 1996. 16.91. 16.91. 16.91. 16.91. 0. 6.68. Jul 26, 1996. 16.87. 16.87. 16.87. 16.87. 0. 6.66. Jul 25, 1996. 16.81 ...

Testing the IPO waters - Jul. 29, 1996
NEW YORK (CNNfn) - The current market for initial public offerings is the weakest it has been this year. Despite ...

Indian Ocean Report 7/96
SUMMARY REPORT _WEEKLY TEMPERATURE ANOMALY MAP (IND) JUL 01-JUL 29 1996 (183-211) ID EXP END LAT END LON S.T. E.T. ...

Poster
Endangered Missing. EDUARDO CANALES. DOB: Jul 29, 1996. Missing: Aug 13, 1998. Age Now: 13. Sex: Male. Race: Hispanic. Hair: Brown ...

The New Yorker Digital Edition : Jul ...
The New Yorker : Jul 29, 1996. Contents. Comment. Cartoon. The Talk of the Town. The Talk of the Town. The Talk of the Town. Poetry ...

South Atlantic Report 7/96
SUMMARY REPORT _WEEKLY TEMPERATURE ANOMALY MAP (SATL) JUL 01-JUL 29 1996 (183-211) ID EXP END LAT END LON S.T. E.T. ...

SSIAX: Historical Prices for LEGG ...
Jul 29, 1996. 18.51. 18.51. 18.51. 18.51. 0. 7.24. Jul 26, 1996. 18.55. 18.55. 18.55. 18.55. 0. 7.25. Jul 25, 1996. 18.50 ...

News Release Archive 1996
News Releases and Statements For 1996. December 1996. Dec. 11, 1996. Fauci: New Findings on Host Factors Illuminate AIDS ...

Contents of directory mirrors/TheGuide
It is intended to be downloaded and printed at the user's end. Two complete games genres are available: fantasy ...

CHECK UP - The Irish Times - Mon ...
THE National Rehabilitation Board's new information centre in Dundalk opened last week, as a resource on disability issues for ...

News Releases - Government of ...
Jul. 30, 1996 - SIAST 1995 GRADUATE EMPLOYMENT STATISTICS REPORT RELEASED. Jul. ... Jul. 30, 1996 - CARGILL CANOLA CRUSHING PLANT OPENS ...

GovTrack: House Vote #372 (Jul 30, 1996)
Close portions of the conference: H R 3610 Fiscal Year 1997 Department ... Jul 30, 1996 5:02PM. Result: Passed. Related Bill: ...

Tired of "Spam?" - Jul. 30, 1996
NEW YORK (CNNfn) - Junk mail is a fact of everyday life. Now, a new, potentially more annoying electronic version ...

Report: McDonnell, Raytheon in talks ...
... and Raytheon Co. are reportedly considering a merger or an alliance of their giant defense and space operations. ...

IN: KdP - Pernyataan Keprihatinan F
IN: KdP - Pernyataan Keprihatinan F. From: apakabar@clark.net. Date: Tue Jul 30 1996 - 08:15:00 EDT. From: John MacDougall ...

Issues: Economy (r)
Issues: Economy (r) From: apakabar@clark.net. Date: Tue Jul 30 1996 - 08:10:00 EDT. From: John MacDougall <apakabar@clark.net> ...

Furthur Festival 1996 | Grateful Dead
Jul 30 1996. Description: Furthur Festival 1996. Shoreline Amphitheatre, Mountain View, CA. Location(s) Shoreline Amphitheatre ...

CNN - The Hollywood Minute - Jul. 30 ...
The group may have been a spoof, but their album is as real as it gets. " The Rutles," a quartet created for a ...

Ozone Hole Image for July 31, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. July 31, 1996 <Jul. 30, 1996 · Aug. 01, 1996> ...

UNFY: Historical Prices for Unify ...
Jul 30, 1996. 8.75. 9.12. 8.50. 8.63. 8,600. 21.56. Jul 29, 1996. 8.75. 8.75. 8.37. 8.75. 26,600. 21.87. Jul 26, 1996. 8.50 ...

Daily Transmission Statistics
... 133,678 | Jul 29 1996 5.22 5.36 1,562,397,622 168,616 | Jul 30 1996 4.88 5.00 1,459,619,768 157,810 | Jul 31 1996 ...

DESIGN FOR GLASSWARE - Google Patent ...
Jul 30, 1996. D376731. Mug. Dec 24, 1996. Drawings. Drawing. Google Home - About Google - About Google Patents - Google Patents ...

RPFRX: Historical Prices for DAVIS ...
Jul 30, 1996. 16.97. 16.97. 16.97. 16.97. 0. 6.70. Jul 29, 1996. 16.91. 16.91. 16.91. 16.91. 0. 6.68. Jul 26, 1996. 16.87 ...

BUP 314
Jul-30-1996. BUP 314 ... Jul-30-1996. BUP 314. Typ. output characteristics ... Jul-30-1996. BUP 314. Package Outlines ...

Mt. Russell - Climber.Org Trip Report
It even rained at El Portal, the Mt Whitney trailhead. We squeezed in at the Backpacker's Camp. In the middle of ...

Bonds lift stocks higher - Jul. 31, 1996
NEW YORK (CNNfn) - Stocks posted their second straight gain Wednesday as a strong bond market helped mute fears ...

BUP 400
Jul-31-1996. BUP 400 ... Jul-31-1996. BUP 400. Typ. output characteristics ... Jul-31-1996. BUP 400. Package Outlines ...

Daily Transmission Statistics
for Summary Period: Jul 1 1996 to Jul 31 1996 ... 168,616 | Jul 30 1996 4.88 5.00 1,459,619,768 157,810 | Jul 31 1996 ...

Jul
... Data Summary for Jul 1, 1996 - Jul 31, 1996 page: A DATE A I R ... Summary for Jul 1, 1996 - Jul 31, 1996 page: B DATE S O I ...

Ozone Hole Image for July 31, 1996
Daily ozone hole image for July 31, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

A Shore by Timothy Steele | The ...
Wednesday. Jul. 31, 1996 "Prev. Next" E-mail. Share. Digg. del.icio.us. Facebook. A Shore. by Timothy Steele. WEDNESDAY 7/31 ...

GovTrack: Senate Vote #258 (Jul 31, 1996)
A vote in the U.S. Congress. ... On the Motion to Table (motion to table bryan amdt no. 5073 ) ... Jul 31, 1996 3:27PM. Result: ...

Access statistics for Al Mashriq
Access statistics for the period: Jul 1 1996 to Jul 31 1996 ... 4235 Jul 30 1996 | 207959223 5306 Jul 31 1996 | 149602081 ...

Stocks ride bond rally - Jul. 31, 1996
NEW YORK (CNNfn) -- Stocks continued to rally Wednesday as a strong bond market helped mute fears about this week's economic data. ...

New Video Games - New Game Releases ...
New Video Game Releases - GameSpot offers a list of new video games. ... Release Date: Jul 31, 1996 ...

The 1996 Olympics (by Ariel ...
... 31, 1996 Go Brasil Go Jul 31, 1996 My condolences Aug 2, 1996 Top 10 Razones Why Argentina will defeat Nigeria Aug ...

outlookindia.com - Contents - July ...
Contents | MAGAZINE | Jul 31, 1996 ... Jul 31, 1996. Regulars. Delhi Diary ... The page 3 people, the chatterati and those in ...

World-Wide Web Access Statistics for ...
Totals for Summary Period: Jul 1 1996 to Jul 31 1996 ... 34336 | Jul 30 1996 3.93 4.14 167261552 43456 | Jul 31 1996 ...

FRB: H.4.1 Release-- Factors ...
... since * Wednesday Wednesday Wednesday Jul 31, 1996 Jul 24, 1996 Aug 2, 1995 -ASSETS Gold certificate account 11, ...

Issues: Religion (r)
Issues: Religion (r) From: apakabar@clark.net. Date: Wed Jul 31 1996 - 08:09:00 EDT. From: John MacDougall <apakabar@clark.net> ...

Letters, Aug. 12, 1996 - TIME
CAN THIS BOY SAVE THE MONARCHY? ... than to put the future of the Windsors and their reign on his shoulders. ...

AllPolitics - The Insider Index
Thanks, But No Thanks -- Aug. 13, 1996 " ... Kemp The Younger -- Aug. 10, 1996. One Unhappy Governor -- Aug. 10, 1996 ...

The Enquirer - Patrick Crowley - Aug ...
... will file columns from the Republican National Convention in San Diego starting Sunday. Published Aug. 10, 1996. ...

tc-list : Messages : 830-859 of 8488
Aug 10, 1996. 12:10 pm. 844. Differences in MSS Re: 1 John 5:7. Questions Concerning Differences in Manuscript Evidence ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Aug 10, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

The Enquirer - Rob Kaiser - Aug. 10 ...
His column appears on Sundays and Thursdays in The Kentucky Enquirer. He can be reached at 292-7169. Published Aug. 10, 1996. ...

Poster
Endangered Missing. MATTHEW CORTES. DOB: Aug 10, 1996. Missing: Oct 29, 2000. Age Now: 13. Sex: Male. Race: Hispanic. Hair: Black ...

AllPolitics - Kemp Gives Acceptance ...
Dole-Kemp Off And Running -- Aug.10, 1996. AllPolitics home page. Copyright © 1997 AllPolitics All Rights Reserved ...

tc-list : Message: Re: TC articles ...
Aug 10, 1996. 12:10 pm. Differences in MSS Re: 1 John 5:7. Questions Concerning Differences in Manuscript Evidence ...

Sunrise and Sunset for Russia ...
Aug 10, 1996. 4:40 AM. 9:48 PM. 17h 07m 57s. − 6m 50s. 1:15 PM. 40.9° 151.638. Aug 11, 1996. 4:43 AM. 9:44 PM. 17h 01m 06s ...

Ozone Hole Image for August 10, 1996
Daily ozone hole image for August 10, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

SRNA REVIEW OF EVENING NEWS, Aug. 10 ...
SRNA REVIEW OF EVENING NEWS, Aug. 10, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

SRNA REVIEW OF DAILY NEWS, Aug. 10, 1996
SRNA REVIEW OF DAILY NEWS, Aug. 10, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

Poster
Have you seen this child? ANGELA CELENTANO. DOB: Jun 11, 1993. Missing: Aug 10, 1996. Age Now: 17. Sex: Female. Race: Hair: Brown ...

Too complex to exist - The Boston Globe
ON AUG.. 10, 1996, a single power line in western Oregon brushed a tree and shorted out, triggering a massive cascade ...

AllPolitics - E-mail From The Floor ...
... Aug. 11, 1996 ... Republicans may not be crazy about welfare cheats and illegal aliens, but ... Of The Yeahbuts -- Aug. 11, 1996 ...

The Enquirer - Tim Sullivan, - Aug ...
... other side,'' he said. '' That would have a shot.'' Tim Sullivan is an Enquirer columnist. Published Aug. 11, 1996. ...

Vanderbilt Register: July 29-Aug. 11 ...
...The online newspaper of the Vanderbilt community. www.vanderbilt.edu/News/register/Current/register.html. July 29-Aug. 11, 1996 ...

AllPolitics - Narrowing The Gap ...
CNN/USA Today/Gallup Poll -- Aug. 11, 1996. Poll Shows Democrats Viewed More Favorably Than GOP -- Aug. 8, 1996 ...

The Enquirer - Paul Daugherty - Aug ...
Enquirer columnist Paul Daugherty welcomes your comments. Call him at 768-8454, or fax him at 768-8550. Published Aug. 11, 1996. ...

AllPolitics - A Big Welcome - Aug ...
Dole-Kemp Off And Running -- Aug. 11, 1996. Kemp The Younger -- Aug. 10, 1996. for articles about. AllPolitics home page ...

Ozone Hole Image for August 11, 1996
Daily ozone hole image for August 11, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

Sermon Aug 11 1996
A Sermon by Ken Shillito - Winchelsea Aug 11 1996. Preaching Resources. Home. Winchelsea Church. Send me an email ...

SRNA REVIEW OF DAILY NEWS, Aug.11, 1996
SRNA REVIEW OF DAILY NEWS, Aug.11, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

SRNA REVIEW OF EVENING NEWS, Aug. 11 ...
SRNA REVIEW OF EVENING NEWS, Aug. 11, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

U.S. Petroleum Data - Statistics ...
... of barrels except refinery utilization Aug. 9 Aug. 2 Aug. 11 1996 1996 1995 Gasoline production, daily 7.7 7.6 7.3 Distillate ...

Ozone Hole Image for August 10, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. August 10, 1996 <Aug. 09, 1996 · Aug. 11, 1996> ...

Fast FSCC Reset Setup
Fast FSCC Reset Setup. From an email message sent to Jordan Goodman Aug. 11, 1996, in reply to his message from Aug. 10, 1996: ...

outlookindia.com - Contents - August ...
We uncovered the names of 39 MPs, including four ministers. The charges ranged from murder, rape, dacoity, abduction ...

Sunrise and Sunset for Russia ...
Aug 11, 1996. 4:43 AM. 9:44 PM. 17h 01m 06s. − 6m 50s. 1:15 PM. 40.6° 151.614. Aug 12, 1996. 4:47 AM. 9:41 PM. 16h 54m 16s ...

Letters, Aug. 12, 1996 - TIME
CAN THIS BOY SAVE THE MONARCHY? ... Letters, Aug. 12, 1996. Monday, Aug. 12, 1996 ... "There is no better way to ensure ...

Milestones Aug. 12, 1996 - TIME
Milestones Aug. 12, 1996. Monday, Aug. 12, 1996 ... bone in his neck suffered when he crashed into a wall at the Marlboro 500 ...

News Releases - Government of ...
Aug. 12, 1996 - CROP DEVELOPMENT SHOWS IMPROVEMENT. Aug. 12, 1996 - NEW FIVE-YEAR AGREEMENT TO FUND SASKATCHEWAN 4-H COUNCIL ...

At the Welcome Picnic - Aug/12/1996
At the Welcome Picnic - Aug/12/1996. On August 12th 1996, just outside the International House, on the lush green ...

The New Yorker Digital Edition : Aug ...
The New Yorker : Aug 12, 1996. Contents. Comment. The Talk of the Town. The Talk of the Town. The Talk of the Town. Cartoon ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Aug 12, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

Garzarelli still bearish - Aug. 12, 1996
NEW YORK (CNNfn) -- Analyst Elaine Garzarelli -- who rocketed to fame when she correctly predicted the 1987 stock ...

AllPolitics - The Insider Index
Thanks, But No Thanks -- Aug. 13, 1996 "Tell Forbes To Shut Up!" -- Aug. 13, 1996 "My Investment Paid Off" -- Aug. 12, 1996 ...

AllPolitics - News Briefs - Aug. 12 ...
... address at the Democratic National Convention in Chicago, according to sources who spoke on the condition of anonymity. ...

SRNA REVIEW OF EVENING NEWS, Aug. 12 ...
SRNA REVIEW OF EVENING NEWS, Aug. 12, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

Loose lips sink funds - Aug. 12, 1996
NEW YORK (CNNfn) - With analysts now divided about the direction of the stock market, Wall Street is looking more ...

The Enquirer - Paul Daugherty - Aug ...
... columnist Paul Daugherty welcomes your comments. Call him at 768-8454, or fax him at 768-8550. Published Aug. 12, 1996. ...

SRNA REVIEW OF DAILY NEWS, Aug. 12, 1996
SRNA REVIEW OF DAILY NEWS, Aug. 12, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

Ozone Hole Image for August 12, 1996
Daily ozone hole image for August 12, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

UNFY: Historical Prices for Unify ...
Aug 12, 1996. 9.00. 9.12. 9.00. 9.00. 3,100. 22.50. Aug 9, 1996. 9.00. 9.12. 8.94. 9.00. 7,200. 22.50. Aug 8, 1996. 9.00. 9.12 ...

AllPolitics - GOP Women Hit Prime ...
Republican Governors Tout Dole Agenda, Attack Clinton - Aug. 13, 1996 ... Y. City Council To Keynote Address - Aug. 13, 1996 ...

AllPolitics - The Insider Index
Kasich vs. The Party -- Aug. 13, 1996. Thanks, But No Thanks -- Aug. 13, 1996 "Tell Forbes To Shut Up!" -- Aug. 13, 1996 " ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Aug 13, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

CNN - Today/Tomorrow - Aug. 13, 1996
MIAMI (CNN) -- Whenever life beyond Earth is discussed, our next-door-neighbor Mars always seems to be the focal ...

The Enquirer - Paul Daugherty - Aug ...
Enquirer columnist Paul Daugherty welcomes your comments. Call him at 768-8454 or send a fax to 768-8550. Published Aug. 13, 1996. ...

The Enquirer - Patrick Crowley - Aug ...
But Mitch McConnell can't wait to get home. Patrick Crowley covers Kentucky politics for The Enquirer. Published Aug. 13, 1996. ...

U.S. lobbies against Turkey-Iran ...
WASHINGTON (CNNfn) - The United States Tuesday urged Turkey not to go ahead with a planned multi-billion gas deal with Iran. ...

Public Law 104-185 1996-08-13
PUBLIC LAW 104–185—AUG. 13, 1996 ... PUBLIC LAW 104–185—AUG. 13, 1996 (2) C ... PUBLIC LAW 104–185—AUG. 13, 1996 (b) P ...

SRNA REVIEW OF DAILY NEWS, Aug. 13, 1996
SRNA REVIEW OF DAILY NEWS, Aug. 13, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

AllPolitics - Going After Clinton ...
GOP Plans All-Out Assault On Clinton's Record. SAN DIEGO (AllPolitics, Aug. 13) -- The Republicans plan a frontal ...

Ozone Hole Image for August 13, 1996
Daily ozone hole image for August 13, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

Strike still haunts baseball - Aug ...
NEW YORK (CNNfn) - Baseball players and owners are said to be close to a labor agreement that will finally bring ...

Sunrise and Sunset for Russia ...
Aug 13, 1996. 4:50 AM. 9:37 PM. 16h 47m 26s. − 6m 50s. 1:15 PM. 40.0° 151.563. Aug 14, 1996. 4:53 AM. 9:34 PM. 16h 40m 36s ...

Ozone Hole Image for August 12, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. August 12, 1996 <Aug. 11, 1996 · Aug. 13, 1996> ...

Why G.O.P. Tolerates Powell and His ...
Redwood City, Calif., Aug. 13, 1996. Sign In to E-Mail. Print. Times Reader 2.0: Daily delivery of The Times - straight ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Aug 14, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

AllPolitics - Cyber Kids - Aug. 14, 1996
They're not old enough to vote and yet they're surfing through the political web sites, making a few waves of their own. ...

CNN - Today/Tomorrow - Aug. 14, 1996
WESTPORT, Connecticut (CNN) -- From the day it opened, customers have flocked to The Custom Foot in Westport searching ...

The Enquirer - Patrick Crowley - Aug ...
Patrick Crowley's Wednesday column from the Republican National Convention was incorrect. Published Aug. 14, 1996. ...

Aug. 14, 1996
and its consolidated subsidiaries for the second quarter and first six months ended June 30, 1996 and 1995 are summarized ...

AllPolitics - Dole's The One - Aug ...
Dole Calls Veterans Of War "Better Americans" -- Aug. 14, 1996. Dole Gets The Nod Tonight -- Aug. 14, 1996 ...

Are IPOs taking a breather? - Aug ...
NEW YORK (CNNfn) - There's no denying that the initial public offering (IPO) market has taken a beating recently. ...

August 14, 1996 Milwaukee Brewers at ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Aug 14, 1996, Brewers at Orioles Box Score and Play by Play ...

tc-list : Message: Re: Announcing ...
Wed Aug 14, 1996 6:45 pm ... Aug 14, 1996. 10:12 pm ... Aug 14, 1996. 10:32 pm. Re: Announcing "The Encyclopedia ...

Stanford Theatre Schedule for ...
Publication Date: Wednesday Aug 14, 1996. Stanford Theatre Schedule <*C>Playing Wednesday and Thursday: The Navigator ...

tc-list : Message: Re: TC articles ...
Aug 14, 1996. 9:59 pm ... Aug 14, 1996. 10:02 pm ... Aug 14, 1996. 10:32 pm. Re: Announcing "The Encyclopedia of ...

Home page of SOLAR ENERGY SOCIETY ...
<-- Last Updated : Aug 14, 1996 14:52 -> Solar Energy Society of India (SESI) Contents: Contact information. Activities ...

KKR sells American Re - Aug. 14, 1996
The announcement ended weeks of speculation that investment firm Kohlberg Kravis Roberts & Co. would sell the company. ...

SRNA REVIEW OF DAILY NEWS, Aug.14, 1996
SRNA REVIEW OF DAILY NEWS, Aug.14, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

Today's Schedule - Schedule ...
WEDNESDAY, AUG. 14, 1996 7:15 P.M. INTRODUCTION OF THEME: THE COMMON-SENSE REPUBLICAN CONGRESS Gov. George W. Bush ...

Sears nails hardware chain - Aug. 15 ...
Under terms of the deal, which must now be approved by Orchard shareholders and anti-trust regulators, Sears will ...

AllPolitics - The Insider Index
Nervous In San Diego -- Aug. 15, 1996. Tinkering With His Prose -- Aug. 14, 1996. Kasich vs. The Party -- Aug. 13, 1996 ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Aug 15, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

News Releases - Government of ...
Aug. 15, 1996 - AUGUST LAND SALE SETS NEW RECORD. Aug. 15, 1996 ... Aug. 15, 1996 - WESTJET EXPANSION TO CREATE JOBS IN SASKATOON ...

Archive index
Aug. 15, 1996. Aug. 29, 1996. Sept. 12, 1996. Sept. 26, 1996. Oct. 3, 1996. Oct. 10, 1996. Back to Intercom home page ...

Aug. 15, 1996
A deep cut in provincial funds earmarked for upgrading and maintaining UBC's buildings will have a major and lasting ...

TCI faces big challenges - Aug. 15, 1996
NEW YORK (CNNfn) - Tele-Communications Inc. faced its investors Thursday, holding its annual shareholders' meeting ...

AllPolitics - TIME Daily - Aug. 15, 1996
The Whitewater Bounce -- Aug. 15, 1996. Get Out The Kleenex -- Aug. 15, 1996. The Whitewater Bounce. WASHINGTON, D. ...

Archive index
Aug. 15, 1996. Aug. 29, 1996. Sept. 12, 1996. Sept. 26, 1996. Oct. 3, 1996. Oct. 10, 1996. Oct. 17, 1996. Oct. 24, 1996. Oct. ...

Chicago Reader | Issue Archives ...
Comprehensive guide to Chicago ... Review of the Best of the Shangri-Las; The Best of the Angels; Growin' Up Too Fast: The ...

August 15, 1996 Atlanta Braves at ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Aug 15, 1996, Braves at Phillies Box Score and Play by Play ...

Sunrise and Sunset for Russia ...
Aug 15, 1996. 4:56 AM. 9:30 PM. 16h 33m 47s. − 6m 48s. 1:14 PM. 39.4° 151.510. Aug 16, 1996. 4:59 AM. 9:26 PM. 16h 26m 58s ...

Poster
Endangered Missing. DESIREE LOPEZ. DOB: Nov 26, 1978. Missing: Aug 15, 1996. Age Now: 31. Sex: Female. Race: White/Hisp. Hair: ...

SRNA REVIEW OF DAILY NEWS, Aug. 15, 1996
SRNA REVIEW OF DAILY NEWS, Aug. 15, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

AllPolitics - E-mail From The Floor ...
Posted: Aug. 15, 1996 ... the convention floor was built in 1984 ... Subject: More Life In The Anchorbooth -- Aug. 15, 1996 ...

Aug-16-1996 - NOFX Wiki
NOFX Wiki: the best source for lyrics, guitar tablatures, bass tabs, ... Retrieved from "http://nofxwiki.net/w/Aug-16-1996" ...

AllPolitics - Editorial Reactions To ...
Revved-Up Dole Hits Campaign Trail - Aug. 16, 1996. Dole Creeping Up On Clinton In CNN Poll - Aug. 15, 1996. GOP ...

News Releases - Government of ...
Aug. 16, 1996 - AGRICULTURE DEVELOPMENT FUND PROJECT APPROVALS ANNOUNCED. Aug. 15, 1996 - AUGUST LAND SALE SETS NEW RECORD ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Aug 16, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

Buffett was right - Aug. 16, 1996
Three months after the controversial Berkshire Hathaway Class B shares hit the market, investment guru Warren Buffet's ...

Scarlet's Web -8/16/96 - Menu
Aug. 16, 1996. Features. News in Brief. Calendar. Arts. For the Record. Jobs. Special Feature. Back to main menu ...

CNN - 'Tin Cup': above par - Aug. 16 ...
Writer-director Ron Shelton scored big with "Bull Durham" and "White Men Can't Jump" but tanked -- big-time -- with ...

CNN - Home Video Preview - Aug. 16, 1996
But about halfway through the movie, "Dusk" seems to have been hijacked by Steven King. The film is a minor work ...

Grain Supply Update: Aug. 16, 1996
Subject: Grain Supply Update: Aug. 16, 1996 ... Date: Fri, 16 Aug 1996 13:56:28 -0400. Article: 14266 of alt.sustainable. ...

The Enquirer - Paul Daugherty - Aug ...
Enquirer columnist Paul Daugherty welcomes your comments. Call him at 768-8454 or send a fax to 768-8550. Published Aug. 16, 1996. ...

White's expert opinion - Aug. 16, 1996
NEW YORK (CNNfn) - Our expert opinion comes from Rick White, stock market strategist and managing director of Salomon ...

Weekly Checklist 96-33 (Aug. 16, 1996)
How to Print Your Order | Order Form for Lynx Users. Weekly Checklist 96-33 (Aug. 16, 1996) For use by persons ...

Sunrise and Sunset for Russia ...
Aug 16, 1996. 4:59 AM. 9:26 PM. 16h 26m 58s. − 6m 49s. 1:14 PM. 39.1° 151.482. Aug 17, 1996. 5:03 AM. 9:23 PM. 16h 20m 10s ...

Stanford Theatre Schedule for Friday ...
Publication Date: Friday Aug 16, 1996. Stanford Theatre Schedule <*C>Playing Friday through Tuesday: Ninotchka ...

SRNA REVIEW OF DAILY NEWS, Aug. 16, 1996
SRNA REVIEW OF DAILY NEWS, Aug. 16, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

Sex -- Saturday, Aug. 17, 1996
Laura Chiles, Jennifer Leven and Scott Perkins. Elevators are just one of the public places students have been fined ...

CNN - Computer Connection Newsreel ...
... Corp. and Bill Gates have flexed their strength once again, launching a new version of Microsoft Internet Explorer. ...

Watch out for Warren! - Climber.Org ...
When Warren Storkman tells you "we did this in 12 hours when I was your age", it's a sure bet you're in for a long hike...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Aug 17, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

Nittany Lion -- Saturday, Aug. 17, 1996
Shawn Knapp. The Nittany Lion -- whether "in person" or in stone -- is a target for attack during football weekends. ...

Wyman Series
From the "Jitro" Czech Girls Choir to pianist George Winston, UW-River Falls will present some of the finest performers ...

The Enquirer - Krista Ramsey - Aug ...
... The Enquirer on Saturdays. Write her at 312 Elm St., Cincinnati 45202 or fax at 768-8340. Published Aug. 17, 1996. ...

AllPolitics - President Clinton's ...
This morning, I want to talk with you about my plan for our nation's economy, about the differences between my plan ...

Obituaries
A native of Banks County, Miss Ray was a daughter of the late Lindsey and Recie Pritchett Ray. She was a member ...

SRNA REVIEW OF DAILY NEWS, Aug.17, 1996
SRNA REVIEW OF DAILY NEWS, Aug.17, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

Arts & Culture Corner (r)
Arts & Culture Corner (r) From: apakabar@clark.net. Date: Sat Aug 17 1996 - 05:56:00 EDT. From: John MacDougall <apakabar@clark.net> ...

SRNA REVIEW OF EVENING NEWS Aug 17, 1996
SRNA REVIEW OF EVENING NEWS Aug 17, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

"Wipo" 3100108/1996
"WIPO" : 3100108/1996 - COCK. PRIZE-LIST : Aug 17, 1996, 22nd. prize vs. 150 pigeons (14.67 %) on CHARTRES - ICHTEGEM - YOUNG BIRDS ...

USA TODAY Latest news
... Miss., addresses the audience at the College Football Hall of Fame where he was inducted Saturday, Aug. 17, 1996 (AP) ...

Ozone Hole Image for August 16, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. August 16, 1996 <Aug. 15, 1996 · Aug. 17, 1996> ...

McGinest goes to Browns - Boston.com
Aug. 18, 1996. McGinest sacked Eagles quarterback Rodney Pete during a preseason game in Foxborough. (Globe Staff Photo / John ...

Don's Dugout
Don's Dugout. Aug 18, 1996. Last modified Oct 24, 1997. In addition to loading the sound and graphics data, the game will need ...

tc-list : Messages : 851-880 of 8488
Aug 18, 1996. 1:55 am. 862 ... Aug 18, 1996. 3:57 am. 865 ... Aug 18, 1996. 9:06 am. 868. Re: Announcing "The Encyclopedia ...

1996 Line Scores
... Series. SUMMARY GAME 3. EUROPE (Home) vs. FAR EAST (Visitor) Aug 18, 1996 5:11 PM Lamade Stadium. Game Scoring By Inning: 1 ...

The Enquirer - Paul Daugherty - Aug ...
... Paul Daugherty welcomes your comments. Call him at 768-8454 or send a fax to 768-8550. Published Aug. 18, 1996. ...

tc-list : Message: Re: Announcing ...
Aug 18, 1996. 1:55 am ... Aug 18, 1996. 2:29 am ... Aug 18, 1996. 3:59 am. Re: Announcing "The Encyclopedia of New ...

Dark Alliance: The Story Behind the ...
neighborhoods in early '80s to help finance war -- and a plague was born. Published: Aug. 18, 1996. Stories. How ...

YouTube - Prong - Unfortunately ...
Search. Browse Upload. Create Account Sign In. Prong - Unfortunately - Aug 18 1996 Bizarre Festival. removethesite ...

Ozone Hole Image for August 18, 1996
Daily ozone hole image for August 18, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

The Enquirer - Patrick Crowley - Aug ...
... Kentucky politics for The Enquirer. His column appears Sunday. He can be reached at 292-7174. Published Aug. 18, 1996. ...

Sermon Aug 18 1996
A Sermon by Ken Shillito - Winchelsea Aug 18 1996. Preaching Resources. Home. Winchelsea Church. Send me an email ...

IFOR : AFSOUTH Transcript of Press ...
... then go to Geneva on Wednesday for the meeting between President Izetbegovic, President Milosevic and President Tudjman. ...

SRNA REVIEW OF DAILY NEWS, Aug. 18, 1996
SRNA REVIEW OF DAILY NEWS, Aug. 18, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

Obituaries
Miss Austine Ray, 89, died Sunday, Aug. 18, 1996. ... Willie Frank Chapman, of 812 Warrenton Road, died Sunday, Aug. 18, 1996. ...

U.S. Petroleum Data - Statistics ...
... barrels except refinery utilization Aug. 16 Aug. 9 Aug. 18 1996 1996 1995 Gasoline production, daily 7.8 7.7 7.6 Distillate ...

Notebook: Aug. 19, 1996 - TIME
Notebook: Aug. 19, 1996. Monday, Aug. 19, 1996 ... JACKIE KENNEDY ONASSIS She died in 1994, but bios of her still rivet us ...

Letters:: Aug. 19, 1996 - TIME
Letters:: Aug. 19, 1996. Monday, Aug. 19, 1996 ... The ability of witnesses to sympathize is something so nobly human, so ...

AllPolitics - A CNN/USA Today/Gallup ...
Aug. 19, 1996. Interviews with 1,188 adult Americans, including 1,006 registered voters, conducted August 16-18, 1996. ...

News Releases - Government of ...
Aug. 19, 1996 - HARVESTING OF SPRING-SEEDED CROPS UNDER WAY. Aug. 19, 1996 - 18.7 MILLION SEEDED ACRES INSURED WITH SCIC ...

Disney is Broadway bound - Aug. 19, 1996
... King David, a limited run biblical musical, and the first production for its newly-renovated New Amsterdam theater. ...

Online NewsHour: Roger Rosenblatt Essays
Aug. 19, 1996. Hiding in the Open. July 1, 1996. Winslow Homer. July 4, 1996. One Nation After All. July 1, 1996. Work in Progress ...

1996 Line Scores
1996 World Series. SUMMARY GAME 2. U.S. SOUTH (Home) vs. U.S. CENTRAL (Visitor) Aug 19, 1996 2:06 PM Lamade Stadium ...

1996 Line Scores
... Series. SUMMARY GAME 4. U.S. EAST (Home) vs. U.S. WEST (Visitor) Aug 19, 1996 8:06 PM Lamade Stadium. Game Scoring By Inning: ...

CNN - In other news... - Aug. 19, 1996
ATLANTA, Georgia (CNN) -- The only publicly identified suspect in the fatal Centennial Olympic Park bombing is considering ...

Feature arts Photo - 8/2/96
Collegian photo / Travis Frey. Adam Gerlach (senior-film and video) paints his version of the Palmer Museum of Art ...

IFOR : AFSOUTH Transcript of Press ...
... IFOR press briefing by Mr Ed Vantein, co-ordinator for International Monitoring, this is the CIM, monitoring the elections ...

What's New at National Semiconductor
Aug 19, 1996 – National Semiconductor today announced release of the LM9801, a highly integrated sensor processor ...

Mexico meets the major leagues - Aug ...
NEW YORK (CNNfn) -- Where can you be serenaded by strolling mariachis, try a tasty Mexican treat, and buy a first ...

The New Yorker Digital Edition : Aug ...
The New Yorker : Aug 19, 1996. Contents. Comment. Cartoon. The Current Cinema. The Talk of the Town. The Talk of the Town ...

SSIAX: Historical Prices for LEGG ...
Aug 19, 1996. 19.16. 19.16. 19.16. 19.16. 0. 7.49. Aug 16, 1996. 19.13. 19.13. 19.13. 19.13. 0. 7.48. Aug 15, 1996. 19.07 ...

News Releases - Government of ...
Aug. 20, 1996 - SOCIAL PROGRAMS ... Aug. 20, 1996 - STRONG ECONOMY MEANS MORE MONEY FOR HEALTH. Aug. 20, 1996 - COMMISSION RULES ON ...

Childcare through agencies - Aug. 20 ...
NEW YORK (CNNfn) -- Leaving home is never easy, but it is easier when you have good childcare. For fees ranging ...

Column - Aug. 20, 1996
Jul. 26, 1996. Sep. 3, 1996. Column Index - Aug. 20, 1996. a) The possibility of the <Atopic> Yukiko SHIKATA. Column ...

Column - Jul. 26, 1996
Aug. 20, 1996. Column Index - Jul. 26, 1996 ... After his debut as a soloist dancer in 1981, Saburo TESHIGAWARA founded the ...

1996 Line Scores
... Series. SUMMARY GAME 6. U.S. WEST (Home) vs. U.S. CENTRAL (Visitor) Aug 20, 1996 2:06 PM Lamade Stadium. Game Scoring By Inning: ...

Real-Time Protocols for Continuous Media
RT-Mach Workshop at CMU. Aug. 20, 1996. Seiji Kihara / NTT Laboratories ... Aug. 20, 1996. Seiji Kihara / NTT Laboratories ...

CNN - Image Gallery - Aug. 20, 1996
You said it... © 1996 Cable News Network, Inc. All Rights Reserved. Terms under which this service is provided to you. ...

AllPolitics - DNC '96 - News
Clinton Signs Minimum Wage Bill -- Aug.20, 1996. Dole Tightens The Race -- Aug. 20, 1996. Don't Get Ahead Of Me, Newt -- Aug. 20, 1996 ...

1996 Line Scores
... Series. SUMMARY GAME 7. LATIN AMERICA (Home) vs. FAR EAST (Visitor) Aug 20, 1996 5:00 PM Lamade Stadium. Game Scoring By Inning: ...

The Enquirer - Paul Daugherty - Aug ...
... in helping with the Big Brothers & Big Sisters program, contact the agency at 421-4120. Published Aug. 20, 1996. ...

The war in Bosnia index
Sarajevo prepares for world-class track meet - Aug. 20, 1996. Croats, Muslims agree on governing Mostar - August 6, 1996 ...

Obituaries
... Church Road, died Tuesday, Aug. 20, 1996. ... of Brian and Laura Pearson Anderson, died Tuesday, Aug. 20, 1996. ...

The Enquirer - Rob Kaiser - Aug. 20 ...
... No. 12. Rob Kaiser is The Enquirer's Kentucky columnist. He can be reached at 292-7169. Published Aug. 20, 1996. ...

AllPolitics - Voter's Voice - August ...
Robert Dole's acceptance speech and final impressions -- Aug 20, 1996. Robert Dole's tax plan -- Aug 5, 1996 "Even ...

Slate - Theater - Aug. 20, 1996
"No symbols where none intended," warns the famous line in Samuel Beckett's novel Molloy, but his interpreters have ...

News Releases - Government of ...
Aug. 21, 1996 - NOMINATIONS OPEN FOR SASKATCHEWAN VOLUNTEER MEDAL. Aug. 21, 1996 - STEP OFFICIALLY LAUNCHED ...

P.L. 104-191
AUG. 21, 1996. HEALTH INSURANCE PORTABILITY AND ACCOUNTABILITY ACT OF 1996. Public Law 104-191. 104th Congress. An Act ...

1996 Line Scores
... Series. SUMMARY GAME 8. U.S. SOUTH (Home) vs. U.S. EAST (Visitor) Aug 21, 1996 8:06 PM Lamade Stadium. Game Scoring By Inning: ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Aug 21, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

1996 Line Scores
1996 World Series. SUMMARY GAME 10. U.S. CENTRAL (Home) vs. U.S. EAST (Visitor) Aug 21, 1996 2:06 PM Lamade Stadium ...

AllPolitics - Closing The Gap - Aug ...
According to an independent Field Institute survey, Clinton leads Dole 45-35 percent, with the Reform Party's Ross ...

AllPolitics - DNC '96 - News
... Reform -- Aug.21, 1996. Dole Tries The Classroom -- Aug.21, 1996 ... Clinton signed a bill Wednesday that will make it easier for ...

ValuJet's return to skies is delayed ...
Spokesman Greg Kenyon told CNN that the airline is still waiting for Federal Aviation Agency and Department of Transportation ...

Ozone Hole Image for August 21, 1996
Daily ozone hole image for August 21, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

Venture fund backs Java - Aug. 21, 1996
NEW YORK (CNNfn) -- A high-tech "Dream Team" has reportedly launched a venture-capital fund to investor in start ...

Poster
Endangered Missing. MICHAEL HUDSON. DOB: Aug 21, 1996. Missing: Aug 9, 1998. Age Now: 13. Sex: Male. Race: White/Hisp. Hair: Brown ...

HEALTH INSURANCE PORTABILITY AND ...
PUBLIC LAW 104–191—AUG. 21, 1996 ... PUBLIC LAW 104–191—AUG. 21, 1996 (C) I ... PUBLIC LAW 104–191—AUG. 21, 1996 (3) P ...

1996 Penn State depth chart ...
Collegian Graphic/Walter Barrueto [RETURN TO OFFENSE STORY] Copyright © 1996, Collegian Inc., Last Updated - 8/21/96 1:25:06 AM ...

SRNA REVIEW OF DAILY NEWS, Aug. 21, 1996
SRNA REVIEW OF DAILY NEWS, Aug. 21, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

Stanford Theatre Schedule for ...
Publication Date: Wednesday Aug 21, 1996. Stanford Theatre Schedule <*C>Playing Wednesday and Thursday: The General ...

1996 Line Scores
1996 World Series. SUMMARY GAME 14. LATIN AMERICA (Home) vs. FAR EAST (Visitor) Aug 22, 1996 8:00 PM Lamade Stadium ...

AllPolitics - An Economics Primer ...
Perot Says Major Parties Skirt The Thorny Issues. LOUISVILLE, Ky. (AllPolitics, Aug. 22) -- In a biting but focused ...

1996 Line Scores
... Series. SUMMARY GAME 13. U.S. SOUTH (Home) vs. U.S. EAST (Visitor) Aug 22, 1996 5:00 PM Lamade Stadium. Game Scoring By Inning: ...

110 STAT. 2293 PUBLIC LAW 104–193 ...
PUBLIC LAW 104–193—AUG. 22, 1996 ... PUBLIC LAW 104–193—AUG. 22, 1996 (II) R ... PUBLIC LAW 104–193—AUG. 22, 1996 (2) I ...

Ingram Micro: Press Releases: Aug ...
INGRAM MICRO AWARDED "INTEGRATORS CHOICE AWARD" BY NETWORK VAR MAGAZINE. Company's Premier VAR Plus Program Received Top Marks ...

AllPolitics - DNC '96 - News
Managing The News -- Aug. 22, 1996. Tobacco Tug-Of-War -- Aug. 22, 1996. Managing The News. WASHINGTON, D.C.: Every ...

The Enquirer - Rob Kaiser - Aug. 22 ...
His column appears Sundays and Thursdays in The Kentucky Enquirer. He can be reached at 292-7169. Published Aug. 22, 1996. ...

UNFY: Historical Prices for Unify ...
Aug 22, 1996. 9.00. 10.00. 9.00. 10.00. 37,800. 25.00. Aug 21, 1996. 8.63. 8.88. 8.25. 8.88. 48,900. 22.19. Aug 20, 1996. 8.63 ...

CNN - Both sides wary as Chechnya ...
Yeltsin reappears, undercuts Lebed on Chechnya - Aug. 22, 1996. Russian troops unleash savage attack in Chechnya - Aug. 21, 1996 ...

U.S. tobacco fallout felt in Europe ...
Tobacco firms under pressure Thursday - - Aug. 22, 1996. B&W gets smoked in court - July 11, 1996. Please create ...

Chicago Reader | Issue Archives ...
Comprehensive guide to Chicago ... Google the site Search our articles archive Search for an event " Previous Issue. Next ...

The Enquirer - Tim Sullivan, - Aug ...
... guy today would have that same get-up and go.'' Tim Sullivan is an Enquirer columnist. Published Aug. 22, 1996. ...

Dow nears record again - Aug. 22, 1996
NEW YORK (CNNfn) - A rally in technology shares and a surprise cut in German interest rates helped stocks overcome ...

IN: ETHRC - Progress Report: Nivio
Date: Thu Aug 22 1996 - 06:46:00 EDT. From: John ... Written 1:41 AM Aug 22, 1996 by peg:etchrmel in igc:reg.easttimor ...

SRNA REVIEW OF EVENING NEWS, Aug. 22 ...
SRNA REVIEW OF EVENING NEWS, Aug. 22, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

News Releases - Government of ...
Aug. 23, 1996 - ONE-YEAR SUSPENSION ORDER ... Aug. 23, 1996 - HARASSMENT COMPLAINTS SETTLED BY HUMAN RIGHTS COMMISSION ...

Tobacco cos. likely to sue - Aug. 23 ...
President declares nicotine addictive - - Aug. 23, 1996. Jury gets tobacco case - Aug. 22, 1996. B&W gets smoked ...

1996 Line Scores
... Series. SUMMARY GAME 15. U.S. EAST (Home) vs. FAR EAST (Visitor) Aug 23, 1996 2:53 PM Lamade Stadium South Williamsport, Pa. ...

Helping Gen X'ers plan their ...
NEW YORK (CNNfn) - Generation X'ers -- those people in their 20s and 30s too young to be considered "Baby Boomers" ...

Scarlet's Web -8/23/96 - Menu
Aug. 23, 1996. Features. News in Brief. Calendar. Arts. Jobs. Back to main menu. For questions regarding these Scarlet ...

News - Articles - 1426267 - 19960823
Aug 23 1996 12:00 AM EDT 21 ... Aug. 23, 1996 -- The fifth annual H.O.R.D.E. tour is out on the road right now, starring ...

The Enquirer - Tim Sullivan, - Aug ...
... Carter was ''When?'' Ifs are not an improvement. Tim Sullivan is an Enquirer columnist. Published Aug. 23, 1996. ...

Ozone Hole Image for August 23, 1996
Daily ozone hole image for August 23, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

Police log - Thursday, Aug. 23, 1996
Police log. Thursday, Aug. 23, 1996. Accident: William L. and Sylvia Guhl of Philadelphia reported Tuesday that ...

Wyman Series
Aug. 23, 1996. Wyman Performance Series Features Top Names. From the "Jitro" Czech Girls Choir to pianist George ...

August 23, 1996 Oakland Athletics at ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Aug 23, 1996, Athletics at Yankees Box Score and Play by Play ...

Weekly Checklist 96-34 (Aug. 23, 1996)
How to Print Your Order | Order Form for Lynx Users. Weekly Checklist 96-34 (Aug. 23, 1996) For use by persons ...

CFJ ARCHIVE (251-265)
3rd Judge: Niccolo Flychuck (selected Aug 23, 1996, 17:58h New York Time) Judgement: TRUE. Statement: The Assistant ...

News - Articles - 1427575 - 19960823
Aug 23 1996 12:00 AM EDT 46 ... Aug. 23, 1996 -- It's been an interesting year for the Cranberries so far, filled ...

Joe Jurevicius photo
Not only is Jurevicius the new starting split end, he has the added pressure of filling the shoes of Bobby Engram, ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Aug 24, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

The Enquirer - Krista Ramsey - Aug ...
... The Enquirer on Saturdays. Write her at 312 Elm St., Cincinnati 45202 or fax at 768-8340. Published Aug. 24, 1996. ...

SRNA REVIEW OF EVENING NEWS, Aug. 24 ...
SRNA REVIEW OF EVENING NEWS, Aug. 24, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

AllPolitics - DNC '96 - Interactive
Delegate Diary. Aug. 24, 1996 "Chicago has acted as if its mother was coming to visit." Linda Johnson, Portland, Ore. ...

SRNA REVIEW OF DAILY NEWS, Aug. 24, 1996
SRNA REVIEW OF DAILY NEWS, Aug. 24, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

The Enquirer - Alan Vonderhaar - Aug ...
Alan Vonderhaar writes for the Cincinnati Enquirer. He welcomes email: alanv(at)gte.net. Published Aug. 24, 1996. ...

Grasshoppers - Luzern (Aug 24, 1996)
Grasshoppers - Luzern (Aug 24, 1996) Luzern started very well, with two opportunities for Agent Sawu within the first 5 minutes. ...

The Wound - By Jack Shafer - Slate ...
The WoundHow bashful is Dole about his wartime injury? By Jack ShaferPosted Saturday, Aug. 24, 1996, at 3:30 AM ET ...

CNN - Computer Connection News Reel ...
Battle of the browsers - Aug. 24, 1996. Microsoft works to fix browser's glitch - Aug. 17, 1996. Related sites: ...

SLATE numbers. - By Michael Kinsley ...
By Michael KinsleyPosted Saturday, Aug. 24, 1996, at 3:30 AM ET. SLATE numbers. We have a slightly better fix on ...

Ozone Hole Image for August 23, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. August 23, 1996 <Aug. 22, 1996 · Aug. 24, 1996> ...

"Wipo" 3100108/1996
prize vs. 150 pigeons (14.67 %) on CHARTRES - ICHTEGEM - YOUNG BIRDS. Aug 24, 1996, 1st. ... Aug 24, 1996, 13th. ...

Resources: Online & Disk Media (r)
Resources: Online & Disk Media (r) From: apakabar@clark.net. Date: Sat Aug 24 1996 - 07:51:00 EDT. From: John MacDougall ...

Daily Transmission Statistics
... 3.37 3.22 842,448,854 110,843 | Aug 23 1996 2.34 2.48 648,515,900 76,925 | Aug 24 1996 2.45 2.60 678,325,864 80, ...

Issues: Economy (r)
Issues: Economy (r) From: apakabar@clark.net. Date: Sat Aug 24 1996 - 07:51:00 EDT. From: John MacDougall <apakabar@clark.net> ...

George's world
Choose the low-graphics English version to prevent World-Wide-Wait. Those have a Chinese environment can try this page now. ...

Tekken 2 for PlayStation - Tekken 2 ...
Tekken 2 for PlayStation - GameSpot offers ... Release Date: Aug 25, 1996 ... Release: Aug 25, 1996 " ESRB: Teen. More Info ...

The Enquirer - Tim Sullivan, - Aug ...
... said. '' I think I made a good impression here.'' Tim Sullivan is an Enquirer columnist. Published Aug. 25, 1996. ...

The Enquirer - Paul Daugherty - Aug ...
... have taken wing and carried him to a special, unforgettable place. Way friggin' up there. Published Aug. 25, 1996. ...

Ozone Hole Image for August 25, 1996
Daily ozone hole image for August 25, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

Sermon Aug 25 1996
A Sermon by Ken Shillito - Winchelsea Aug 25 1996. Preaching Resources. Home. Winchelsea Church. Send me an email ...

CNN - New fake fat: tastes good ...
Fat, the part of food that helps make it palatable, is a major no-no in the battle of the bulge, and to date fat ...

CNN - Campaign sites - Aug. 25, 1996
Prepare yourself for campaign Web pages with glitzy graphics, snazzy television ads, fancy games and even some candidate ...

Aug. 25, 1996 (PST)
Aug. 25, 1996 (PST) Aug. 25, 1996 (PST) ... Aug. 25, 1996 (PST) ...

SRNA REVIEW OF DAILY NEWS, Aug. 25, 1996
SRNA REVIEW OF DAILY NEWS, Aug. 25, 1996. Srpska Republica News Agency (SRNA) Directory - Previous Article - Next Article ...

TWU - TWU Libraries - 1996 TWU Update
Aug 19-Aug 25, 1996. Aug 5-Aug 18, 1996. Jul 22-Aug 4, 1996. Jul 8-Jul 21, 1996. Jun 24-Jul 7, 1996. Jun 10-Jun 23, 1996 ...

Issues: Economy (r)
Issues: Economy (r) From: apakabar@clark.net. Date: Sun Aug 25 1996 - 07:14:00 EDT. From: John MacDougall <apakabar@clark.net> ...

IN/POL: SBYP - Mochtar Lubis Undurk
IN/POL: SBYP - Mochtar Lubis Undurk. From: apakabar@clark.net. Date: Sun Aug 25 1996 - 06:25:00 EDT. From: John MacDougall ...

New Video Games - New Game Releases ...
New Releases Week of Aug 25, 1996 ... Players looking for an old-school platform game with ... Release Date: Aug 25, 1996 ...

SIGCOMM '96
... SIGCOMM '96 at Stanford Univ., Palo Alto, CA. Aug. 25 to Aug. 31. Aug. 25, 1996. Aug. 26, 1996. Aug. 27, 1996. Aug. 28, 1996 ...

Notebook: Aug. 26, 1996 - TIME
... DOUGLAS WALLER Monday, Aug. 26, 1996 ... just within sight of an oil-tank farm and is located near a busy shipping ...

Contributors: Aug. 26, 1996 - TIME
Monday, Aug. 26, 1996. Print. Email. Digg. Facebook ... of spinal-cord injuries for this week's cover story on Christopher Reeve. ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Aug 26, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

CNN - U.S. Briefs - Aug. 26,. 1996
... Snell gave closing arguments Monday in the trial of three men accused of plotting a terror campaign against the United States. ...

AllPolitics - "Nothing Is Impossible ...
As It Happened: Monday Night At The Democratic National Convention -- Aug. 26, 1996. After 28 Years, Democrats Return -- Aug. 26, 1996 ...

High altitudes, high rollers - Aug ...
NEW YORK (CNNfn) - While aircraft manufacturers strive to make flying safer, one firm is trying to add an element ...

AllPolitics - News Briefs - Aug. 26 ...
CHICAGO (AllPolitics, Aug. 26) -- In the absence of real drama this week, political junkies here can't help but ...

Face the Nation : Aug 26, 1996 ...
... years, 1,915 covers and 49,833 stories from PEOPLE magazine's history for you to enjoy. Aug 26, 1996 Vol. 46 No. 9 ...

(Archived) f96releases
Kinder, Gentler Student Assessment (Aug. 26, 1996) ... College of Education Goes High-Tech (Aug. 26, 1996) ...

The Enquirer - Patrick Crowley - Aug ...
... just blowin' a lot of smoke. Patrick Crowley covers Kentucky politics for The Enquirer. Published Aug. 26, 1996. ...

The Enquirer - Paul Daugherty - Aug ...
So was he. The players themselves are usually the last to know. Paul Daugherty is an Enquirer columnist. Published Aug. 26, 1996. ...

Bad U.S. health plans abound - Aug ...
NEW YORK (CNNfn) - What makes for a bad health-care plan? According to a survey of 72,000 patients conducted by ...

The New Yorker Digital Edition : Aug ...
The New Yorker : Aug 26, 1996. Contents. Comment. Cartoon. The Current Cinema. The Talk of the Town. The Talk of the Town ...

Week 114 - Aug. 26, 1996
... bulk Reply-To: kgstar@most.fw.hac.com (Kelly Starks x7066 MS 10-39) I uploaded the latest drafts of LIT web stuf. ...

Women's Soccer
Collegian Photo/Jeff Cramer. Rachel Hoffman cranks up for a shot against Duquesne University. Hoffman and the rest ...

AllPolitics - Foster's Note - Aug ...
Memo Links First Lady To Handling Of Suicide Note. WASHINGTON (AllPolitics, Aug. 27) -- The same day Hillary Clinton ...

News Releases - Government of ...
Aug. 27, 1996 - EDUCATION RESPONDS TO CHANGING NEEDS OF STUDENTS. Aug. 27, 1996 ... Aug. 27, 1996 - GOOD WEATHER HELPING TO RIPEN CROPS ...

Money pouring into Mexico - Aug. 27 ...
NEW YORK (CNNfn) - Money poured into Mexico from across the borders Tuesday as investors bid of the nation's stock ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Aug 27, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

AllPolitics - Hillary's Hour - Aug ...
Democrats To Emphasize Education Tonight -- Aug. 27, 1996. Hillary Clinton Says Welfare Bill Fixable -- Aug. 27, 1996 ...

"Gopher ReviewTeam: Minutes for Aug ...
Gopher Team. Meeting Minutes. Aug 27, 1996. Attending: Carolyn Berzai (sponsor), Paul Russell, Joel Cooper, Sharon ...

Tue Aug 27 1996 Tooltime Meeting - 1 ...
... MIT.EDU (Steven Wade Neiterman) Tooltime 08/27/96 19:32 (90 lines) Subject: Scopus Implementation Meeting Aug 27, 1996 ...

Ingram Micro: Press Releases: Aug ...
Aug. 27, 1996 (b) Aug. 27, 1996 (a) ... today announced the selection of Jerre L. Stead, 53, as the new chairman and chief ...

Ingram Micro: Press Releases: Aug ...
Aug. 27, 1996 (b) Aug. 27, 1996 (a) ... INGRAM MICRO TO EXPAND ITS BUFFALO OPERATIONS CENTER ... BUFFALO, New York, Aug. 27, 1996 ...

Art Watch - Aug. 27, 1996
Aug. 20, 1996. Sep. 3, 1996. Art Watch Index - Aug. 27, 1996 <<Archaeology of the Future City>> Yoshiharu TSUKAMOTO ...

Boeing News Release: Boeing ...
SEATTLE, Aug. 27, 1996 - The Boeing Company announced today that the production rate for its new 777 jet transport ...

Ozone Hole Image for August 27, 1996
Daily ozone hole image for August 27, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

The Enquirer - Patrick Crowley - Aug ...
... getting to know Mr. Patton. Patrick Crowley covers Kentucky politics for The Enquirer. Published Aug. 27, 1996. ...

Art Information - Sep. 17, 1996
Aug. 27, 1996. Sep. 24, 1996. Art Infomation Index - Sep. 17, 1996 ... The former Studio Shokudo used to be in the employees' ...

Art Information - Aug. 27, 1996
Aug. 6, 1996. Sep. 17, 1996. Art Infomation Index - Aug. 27, 1996. Three Movements in Denmark. Yukiko SHIKATA. Art ...

Wall Street eyes weekend - Aug. 28, 1996
NEW YORK (CNNfn) - Stock prices were decidedly flat Wednesday as Wall Street struggled for motivation ahead of the ...

News Releases - Government of ...
... LABOUR DAY MESSAGE. Aug. 28, 1996 - TAKE PRECAUTIONS ... Aug. 28, 1996 - PUBLIC CONSULTATION MEETINGS ON EDUCATION CONTINUING ...

CNN - 'Mission: Impossible' actor ...
Morris was found dead in his flat by a maintenance worker, and the cause of death was not immediately known. The ...

Big Blue aids Dow - Aug. 28, 1996
NEW YORK (CNNfn) -- Wall Street stocks edged lower at the opening bell Wednesday, but quickly reversed the downtrend ...

Stanford Theatre Schedule for ...
Publication Date: Wednesday Aug 28, 1996. Stanford Theatre Schedule <*C>Playing Wednesday and Thursday: The Gaucho ...

AllPolitics - DNC '96 - News
First Lady Energizes Convention - Aug. 28, 1996. Clinton Chugs toward Chicago - Aug. 27, 1996. Clinton Express - Aug. 26, 1996 ...

The Enquirer - Tim Sullivan, - Aug ...
... choice. It's more alliterative. It has more synergy. Tim Sullivan is an Enquirer columnist. Published Aug. 28, 1996. ...

The Enquirer - Patrick Crowley - Aug ...
... favors legalizing marijuana. Patrick Crowley covers Kentucky politics for The Enquirer. Published Aug. 28, 1996. ...

Ozone Hole Image for August 28, 1996
Daily ozone hole image for August 28, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

Volleyball photo
Collegian File Photo. Heidi Rottinghaus prepares to dig the ball against Ohio State last year. The senior outside ...

Collegian Editorial - Wednesday, Aug ...
The dust has long settled on the 1996 Undergraduate Student Government elections - and in some cases on the platforms ...

New Topics in Europe: Aug 28, 1996 ...
... new topics on Aug 28, 1996 in the Europe ... New Topics: Aug 28, 1996 ... Each website you select will open a new window in ...

Aug. 28, 1996 (PST)
Aug. 28, 1996 (PST) Aug. 28, 1996 (PST) ... Aug. 28, 1996 (PST) ...

RPFRX: Historical Prices for DAVIS ...
Aug 28, 1996. 17.82. 17.82. 17.82. 17.82. 0. 7.04. Aug 27, 1996. 17.81. 17.81. 17.81. 17.81. 0. 7.03. Aug 26, 1996. 17.78 ...

Aug 28, 1996 Minutes : Faculty ...
... Faculty Senate > Senate Documents > Senate Minutes > Minutes of the 38th Faculty Senate > Aug 28, 1996 Minutes ...

uphoto Photo - Carrie Culberson Jan ...
Carrie Culberson Jan. 31, 1974 to Aug. 29, 1996 Courtesy of tangle.com ... Carrie Culberson Jan. 31, 1974 to Aug. 29, 1996 ...

fourteenknuckles Photo - Carrie ...
... Photo - Carrie Culberson Jan. 31, 1974 to Aug. 29, 1996 - tangle.com ... Carrie Culberson Jan. 31, 1974 to Aug. 29, 1996 ...

AllPolitics - No Bounce Yet - Aug ...
... Clinton maintains a 13-point lead over his Republican rival Robert Dole in the latest CNN/USA Today/Gallup Poll. ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Aug 29, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

AllPolitics - Dole's Take - Aug. 29 ...
Dole Reacts To Morris Scandal, Calls ... Strategist Quits -- Aug. 29, 1996. Gore: Dems Are "Bridge To The Future" -- Aug. 29, 1996 ...

DOJ investigation requested - Aug ...
In a letter sent to the Justice Department Thursday Lexis-Nexis said that if the acquisition is not stopped "competition...

Archive index
Aug. 29, 1996. Sept. 12, 1996. Sept. 26, 1996. Oct. 3, 1996. Oct. 10, 1996. Back to Intercom home page. Back to University ...

Archive index
Aug. 29, 1996. Sept. 12, 1996. Sept. 26, 1996. Oct. 3, 1996. Oct. 10, 1996. Oct. 17, 1996. Oct. 24, 1996. Oct. 31, 1996. Nov. 7, ...

The Enquirer - Tim Sullivan, - Aug ...
... Wednesday. '' And I'm not old enough to actually rent one.'' Tim Sullivan is an Enquirer columnist. Published Aug. 29, 1996. ...

PCS auction nears it end - Aug. 29, 1996
WASHINGTON (CNNfn) - The Federal Communications Commission is conducting its final auction of personal communication ...

Ingram Micro: Press Releases: Aug ...
Aug. 29, 1996. Aug. 27, 1996 (b) ... SANTA ANA, Calif., Aug. 29, 1996 ... announced today it has promoted John Hulina to ...

The Enquirer - Rob Kaiser - Aug. 29 ...
... lettering eventually is to read ''Welcome to Williamstown, Gateway to the Bluegrass.'' Published Aug. 29, 1996. ...

Ozone Hole Image for August 29, 1996
Daily ozone hole image for August 29, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

Aug. 29, 1996-Vol28n1: SportsView
It will be UB's 83rd season of intercollegiate football and the earliest date that a season has started in school history. ...

Chicago Reader | Issue Archives ...
Comprehensive guide to Chicago ... Issue Archive for the Week of. Aug 29 - Sep 4, 1996. Vol. 25, No. 47. Music. Abandoning ...

News Releases - Government of ...
Aug. 30, 1996 - SURVEY OF ENDANGERED SHOREBIRD A SUCCESS. Aug. 30, 1996 - LABOUR DAY MESSAGE ... Aug. 28, 1996 - TAKE ...

CNN - In other news... - Aug. 30, 1996
After becoming stranded on the iceberg, the group radioed a passing plane for help. The message was relayed to ...

Ten Biggest U.S. Banks - Aug. 30, 1996
Please create a screen name to access this feature. Screen name (Select one with 3-12 characters; Numbers and letters only) ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Aug 30, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

Myron's Office - Aug. 30, 1996
But if you really want to know who he is, to get to the heart of what Myron's about. you've got to visit his office, ...

Scarlet's Web -8/30/96 - Menu
Aug. 30, 1996. Features. News in Brief. Calendar. Arts. Jobs. For the Record. Back to main menu. For questions regarding ...

110 STAT. 2293 PUBLIC LAW 104–193 ...
is amended by striking , and its plans and schedule for informing. service institutions of the availability of the program''. (j) P ...

Wyman Series
From the "Jitro" Czech Girls Choir to pianist George Winston, UW-River Falls will present some of the finest performers ...

The Enquirer - Patrick Crowley - Aug ...
... forget that this campaign season. Patrick Crowley covers Kentucky politics for The Enquirer. Published Aug. 30, 1996. ...

Ingram Micro: Press Releases: Aug ...
Mr. Stead is the former chairman and chief executive officer of Legent Corporation and AT&T Global Information Solutions ...

Aug. 30, 1996 (PST)
Aug. 30, 1996 (PST) Aug. 30, 1996 (PST) ... Aug. 30, 1996 (PST) ...

RPFRX: Historical Prices for DAVIS ...
Aug 30, 1996. 17.88. 17.88. 17.88. 17.88. 0. 7.06. Aug 29, 1996. 17.89. 17.89. 17.89. 17.89. 0. 7.07. Aug 28, 1996. 17.82 ...

Stanford Theatre Schedule for Friday ...
Publication Date: Friday Aug 30, 1996. Stanford Theatre Schedule <*C>Playing Friday through Tuesday: To Catch a ...

Sask Gazette, Part I, Aug 30, 1996
REGINA, FRIDAY, AUGUST 30, 1996/REGINA, VENDREDI, 30 AOÛT 1996. The Saskatchewan Gazette. TABLE OF CONTENTS/TABLE DES MATIÈRES ...

The Enquirer - Paul Daugherty - Aug ...
Hello . . . world? Sounds like a professional obituary to me. Paul Daugherty is an Enquirer columnist. Published Aug. 30, 1996. ...

IFOR : AFSOUTH Transcript of Press ...
IFOR. AFSOUTH TRANSCRIPT. Aug 31, 1996. In the interest of speed transcripts of IFOR press briefings are issued in ...

Daily Transmission Statistics
for Summary Period: Aug 1 1996 to Aug 31 1996 ... 077 138,313 | Aug 30 1996 2.81 2.74 715,055,027 92,563 | Aug 31 1996 ...

WORLD Magazine | Today's News ...
World Magazine is a full color biweekly news magazine that provides complete coverage of national news and international news, ...

The Enquirer - Tim Sullivan, - Aug ...
... was that the Bearcats were out of their league. Tim Sullivan is an Enquirer columnist. Published Aug. 31, 1996. ...

The Enquirer - Alan Vonderhaar - Aug ...
... .net His wife is news editor of The Enquirer and has developed a great sense of humor. Published Aug. 31, 1996. ...

IN/HR: VOA - Komnas HAM Releases Pr
IN/HR: VOA - Komnas HAM Releases Pr. From: apakabar@clark.net. Date: Sat Aug 31 1996 - 13:13:00 EDT. From: John MacDougall ...

Aug
... for Aug 1, 1996 - Aug 31, 1996 page: A DATE A I R ... min)/2 ] Veg Crops Weather Data Summary for Aug 1, 1996 - Aug 31, 1996 ...

New Video Games - New Game Releases ...
New Video Game Releases - GameSpot offers a ... Release Date: Aug 31, 1996 ... Release Date: Aug 31, 1996. Genre: Platformers ...

Math Forum Discussions - User ...
Aug 31, 1996 2:03 AM. 3 ... Aug 31, 1996 1:14 AM. 7 ... Aug 31, 1996 1:02 AM. 9. Re: Geometry Ideas. k12.ed.math ...

Ozone Hole Image for August 31, 1996
Daily ozone hole image for August 31, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. Last ...

oardc.ohio-state.edu/weatherarchive/...
... Data Summary for Aug 1, 1996 - Aug 31, 1996 page: A DATE A I R T E ... Summary for Aug 1, 1996 - Aug 31, 1996 page: B DATE S ...

- By Anonymous - Slate Magazine
Summaries of what's in Time, Newsweek, etc. By AnonymousPosted Saturday, Aug. 31, 1996, at 3:30 AM ET. Economist, Aug. 31 ...

IN/HR: MI - Pakpahan Case Ready in
IN/HR: MI - Pakpahan Case Ready in. From: apakabar@clark.net. Date: Sat Aug 31 1996 - 13:21:00 EDT. From: John MacDougall ...

CNN - Transcript of Clinton's ...
Ladies and gentlemen, before I make my remarks, I want to report to you on a development in another country you ...

Date: Aug 31, 1996 8:59 AM Author ...
Date: Aug 31, 1996 8:59 AM Author: cornelius@mayo.edu Subject: Re: Beautiful Blonde Needs Answers. In article <5047f4 ...

tc-list : Message: Re: text-type of ...
Sep 10, 1996. 3:48 pm ... Sep 10, 1996. 9:58 pm ... Sep 10, 1996. 11:42 pm. Re: "in ras" ... You may want to look ...

tc-list : Messages : 984-1013 of 8488
Sep 10, 1996. 8:39 am. 985 ... Sep 10, 1996. 3:48 pm. 986 ... Sep 10, 1996. 9:58 pm. 990. Re: text-type of Sinaiticus ...

Healthy goes mainstream - Sep. 10, 1996
A wave of mergers and upcoming IPO's are reshaping the way natural foods, defined by the industry as minimally processed ...

News Releases - Government of ...
Sep. 10, 1996 - EXCAVATION COMPLETED OF A 37 MILLION-YEAR-OLD BRONTOTHERE SKELETON. Sep. 9, 1996 - HARVEST NOW 25 PER CENT COMPLETE ...

Poster
Endangered Missing. SOPHIA LARRANAGA. DOB: Sep 10, 1996. Missing: Feb 11, 1998. Age Now: 13. Sex: Female. Race: Hispanic. Hair: ...

Alternative goes mainstream - Sep ...
NEW YORK (CNNfn) -- The guitar-heavy, garage-band sounds of alternative music have traditionally captured the hearts ...

Art Watch - Sep. 10, 1996
Sep. 3, 1996. Sep. 17, 1996. Art Watch Index - Sep. 10, 1996. Kishin Shinoyama Photo Exhibition "SHOKU" Noi SAWARAGI ...

Art Watch - Sep. 3, 1996
Aug. 27, 1996. Sep. 10, 1996. Art Watch Index - Sep. 3, 1996 ... Thr-Sat 11:00am-6:00pm. 51 Hanbury Street London ...

Poster
... GLAZNER. DOB: Feb 20, 1994. Missing: Sep 10, 1996. Age Now: 16. Sex: Male ... Missing: Sep 10, 1996. Age Now: 17. Sex: Male ...

Ackanomic Party Chess Movement Log ...
Ackanomic PartyChess Play Log. Plays 1 - 50: 10th September 1996 ... Sep 10 1996 00:17 GMT ... Sep 10 1996 11:07 GMT. P R ...

Joint Research Project
Program & Timetable (Revised Sep.10, 1996) Proceedings(Japanese) Report(Nov.29, 1996) VSH-CISTE BBS (Opened Aug.18, 1996) ...

[binary]
... 09/10/96 03:55 PM From: Lawrence Hugh Snyder Date: Tue, Sep 10, 1996 3:55 PM Subject: ps.options() calls To: Hou; ...

Ozone Hole Image for September 09, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 09, 1996 <Sep. 08, 1996 · Sep. 10, 1996> ...

The official Dilbert website with ...
Jul 4, 1999. 72 Votes. 2 Comments. 4.49. Sep 10, 1996. 72 Votes. 4 Comments. 4.08. Jul 11, 1996. 20 Votes. 2 Comments. No ...

SSIAX: Historical Prices for LEGG ...
Sep 10, 1996. 19.08. 19.08. 19.08. 19.08. 0. 7.46. Sep 9, 1996. 19.11. 19.11. 19.11. 19.11. 0. 7.47. Sep 6, 1996. 18.89. 18.89 ...

GovTrack: House Vote #412 (Sep 11, 1996)
Suspend the rules and pass, as amended: H R 3759 Exports, Jobs, and ... Sep 11, 1996 3:51PM. Result: Failed. Related Bill: ...

GovTrack: House Vote #408 (Sep 11, 1996)
On Motion to Instruct Conferees: H R 2202 Immigration Act of 1995 ... Sep 11, 1996 3:03PM. Result: Failed. Related Bill: ...

tc-list : Message: Re: Re: "in ras"
Check them out and nominate your group. ... Joe Adler. Wed Sep 11, 1996 3:37 am ... Sep 11, 1996. 12:40 am. Combined ...

Iraqi conflict leaves impact - Sep ...
NEW YORK (CNNfn) - An Iraqi missile fired at an American fighter jet may have missed, but the event did have some impact. ...

FRB: H.4.1 Release-- Factors ...
Sep 11, 1996. Sep 4, 1996. Sep 11, 1996. Wednesday. Sep 11, 1996. Reserve Bank ... Sep 11, 1996. Wednesday. Sep 4, 1996. Wednesday ...

Tandy to sell for Sprint - Sep. 11, 1996
... services at Tandy Corp.'s RadioShack stores nationwide later this year, the two companies announced Wednesday. ...

FRB: H.4.1 Release-- Factors ...
... since * Wednesday Wednesday Wednesday Sep 11, 1996 Sep 4, 1996 Sep 13, 1995 -ASSETS Gold certificate account 11, ...

IN/MIL: SBYP - Kopassus Terjun Rebu
IN/MIL: SBYP - Kopassus Terjun Rebu. From: apakabar@clark.net. Date: Wed Sep 11 1996 - 19:21:00 EDT. From: John MacDougall ...

Ozone Hole Image for September 11, 1996
Daily ozone hole image for September 11, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

outlookindia.com - Contents ...
... Sep 11, 1996 ... Sep 11, 1996. Regulars ... Random notes, gossip, bitching, angles, conspiracy theories, spoofs, ...

The official Dilbert website with ...
Jul 14, 2008. 499 Votes. 7 Comments. 4.15. Sep 11, 1996. 18 Votes. 4 Comments. 4.12. Jul 4, 1996. 19 Votes. 2 Comments. No ...

IN/MIL: ANTARA - Pesawat Tempur TNI
IN/MIL: ANTARA - Pesawat Tempur TNI. From: apakabar@clark.net. Date: Wed Sep 11 1996 - 17:05:00 EDT. From: John MacDougall ...

SSIAX: Historical Prices for LEGG ...
Sep 11, 1996. 19.13. 19.13. 19.13. 19.13. 0. 7.48. Sep 10, 1996. 19.08. 19.08. 19.08. 19.08. 0. 7.46. Sep 9, 1996. 19.11. 19.11 ...

markm: Best drink in the whole wide ...
To save, rate and share recipes, join now! ... Posted: Sep 11, 1996 4:17 PM. Hell yes. ... Sep 11, 1996 4:17 PM ...

tc-list : Messages : 984-1013 of 8488
Sep 11, 1996. 12:40 am. 993. Combined Heb/Greek OT/NT Text. Help! A few weeks ago, a message was sent over this ...

News Releases - Government of ...
Sep. 12, 1996 - SASKATCHEWAN COMMITTED TO ELIMINATING MEASLES AND RUBELLA ... Sep. 12, 1996 - ROMANOW URGES RECOMMITMENT OF ...

Notebook: Sep. 9, 1996 - TIME
AL GORE Tears, not smoke, in their eyes as he tells delegates of his sister's battle with lung cancer. PHILIP MORRIS ...

tc-list : Message: Combined Heb ...
Thu Sep 12, 1996 1:36 am ... Sep 12, 1996. 5:41 am ... Sep 12, 1996. 6:39 am. Re: Combined Heb/Greek OT/NT Text. At ...

BSP 324
Sep-12-1996. BSP 324 ... Sep-12-1996. BSP 324. Typ. output characteristics ... Sep-12-1996. Semiconductor Group. BSP 324 ...

Archive of the dept-www-providers ...
Archived on: Thu Sep 12 1996 - 15:04:30 BST. Messages sorted by: [ date ][ thread ][ subject ] This archive was ...

Erickson, Sep 12, 1996 - Births ...
Patricia and Eric Erickson. of Spokane, Wash announce the birth of: Erickson. Born: Sep 12, 1996. Weight: 8 lb. 12 oz. ...

The Showbox - Sep 14, 1996 | Pearl ...
Home › Tour › All Setlists " The Showbox - Sep 14, 1996. Tour. All Setlists. 2010 Setlists. 2009 Setlists. 2008 Setlists ...

Sep. 12, 1996-Vol28n03: Greiner to ...
... give his annual year-opening address to the voting faculty at 2 p.m. Tuesday, Sept. 24, in the Center for Tomorrow. ...

Sep. 12, 1996-Vol28n03: Front Page
Camp ACHIEVE helps athletes boost SATs. A group of New York State's top high school athletes who attended a sports ...

tc-list : Message: Re: Combined Heb ...
Thu Sep 12, 1996 9:55 am ... Sep 12, 1996. 6:39 am ... Sep 12, 1996. 2:01 pm. Re: Combined Heb/Greek OT/NT Text ... I ...

1996 | News Releases | News & Media ...
Mitsubishi Chemical Kojin Packs Corporation Starts Operations. Sep. 12, 1996. Business Tie-up Between Mitsubishi ...

Ozone Hole Image for September 12, 1996
Daily ozone hole image for September 12, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

Archive of the dept-www-providers ...
Archived on: Thu Sep 12 1996 - 15:04:30 BST. Messages sorted by: [ date ][ thread ][ author ] This archive was ...

Nyanko's Homepage
W e l c o m e ! To Nyanko's Homepage (updated at: Sep 12, 1996) Now, we can see many beautiful flowers and some insects here. ...

Chicago Reader | Issue Archives ...
The talented Harand sisters were entertainers, but they've left their mark as teachers, instilling in their students ...

News Releases - Government of ...
Sep. 13, 1996 - NEW CURRICULUM TO ENHANCE EDUCATION. Sep. 13, 1996 - MINISTERS TO ... Sep. 13, 1996 - GRAVELBOURG BUSINESS EXPANDS ...

Dow smashes into record - Sep. 13, 1996
NEW YORK (CNNfn) -- Blue-chip stocks rallied Friday, busting into record territory after a weaker-than-expected ...

ReaderWire
... Sep 13, 1996. ReaderWire. Publication Date: Friday Sep 13, 1996 ... Alto (by voice mail) Publication Date: Friday Sep 13, 1996 ...

Consumers battling debt - Sep. 13, 1996
WASHINGTON (CNNfn) - All across the nation, banks and other financial institutions have been sending pre-approved ...

Bentley College vs UMass-Lowell (Sep ...
Scoring Summary (Final) 1996 Bentley College Football Bentley College vs UMass-Lowell (Sep 14, 1996 at Lowell, Mass. ...

E$O DIRTY 30$ block R.i.P.2pac.sep ...
MySpace profile for E$O DIRTY 30$ block R.i.P.2pac.sep,13.1996. Find friends, share photos, keep in touch with classmates, and ...

Ozone Hole Image for September 13, 1996
Daily ozone hole image for September 13, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

World-Wide Web Access Statistics for ...
... 9.15 37760020 4571 | Sep 14 1996 15.94 15.35 63339464 7688 | Sep 13 1996 17.36 17.27 71239615 8370 | Sep 12 1996 ...

GovTrack: House Vote #452 (Sep 28, 1996)
A vote in the U.S. Congress. ... House Vote #452 (Sep 28, 1996) Suspend the rules and pass: H R 3163 State Authority Tax ...

Openhouse listing for Friday Sep 13 ...
Publication Date: Friday Sep 13, 1996. Open House Listings. You can scroll through this list of openhouses or click on one of ...

KDUS.OB: Historical Prices for CADUS ...
Sep 13, 1996. 6.13. 6.75. 6.13. 6.75. 19,700. 6.75. Sep 11, 1996. 6.00. 6.75. 6.00. 6.75. 44,800. 6.75. Sep 10, 1996. 6.00 ...

Ozone Hole Image for September 12, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 12, 1996 <Sep. 11, 1996 · Sep. 13, 1996> ...

BBC ON THIS DAY | Religion
Skip to main content. Low Graphics. Access keys help. Home. Explore the BBC. Themes. Search ON THIS DAY by date ...

tc-list : Message: Re: Combined Heb ...
Message search is now enhanced, find messages ... Sep 13, 1996. 4:50 am ... Sep 13, 1996. 8:49 am. response to Sollamo review ...

SSIAX: Historical Prices for LEGG ...
Sep 13, 1996. 19.34. 19.34. 19.34. 19.34. 0. 7.56. Sep 12, 1996. 19.20. 19.20. 19.20. 19.20. 0. 7.51. Sep 11, 1996. 19.13 ...

Bentley College vs UMass-Lowell (Sep ...
Scoring Summary (Final) 1996 Bentley College Football Bentley College vs UMass-Lowell (Sep 14, 1996 at ...

U. of Chicago vs DePauw (Sep 14, 1996)
... vs DePauw (Sep 14, 1996 at ... Date: Sep 14, 1996 • Site: Greencastle, Indiana • Stadium: Blackstock • Attendance: 1250 ...

DePauw University - Game-by-Game ...
Sep 14, 1996. U. OF CHICAGO. W. 35-0. 1-0-0. 0-0-0 ... Stigall vs U. of Chicago (Sep 14, 1996) ... of Chicago (Sep 14, 1996) ...

plyr_26.htm
... Total TFL-Yds No-Yds FF FR-Yds Int-Yds QBH Brk Kick Att-Mad Run Rcv Saf Pts Sep 14, 1996 at UMass-Lowell. ...

The Showbox - Sep 14, 1996 | Pearl ...
Home › Tour › All Setlists " The Showbox - Sep 14, 1996 ... Sep 14, 1996. Set 1. Sometimes. Hail, Hail ...

World-Wide Web Access Statistics for ...
... 9.48 9.15 37760020 4571 | Sep 14 1996 15.94 15.35 63339464 7688 | Sep 13 1996 17.36 17.27 71239615 8370 | Sep 12 ...

Ozone Hole Image for September 13, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 13, 1996 <Sep. 12, 1996 · Sep. 14, 1996> ...

Ozone Hole Image for September 14, 1996
Daily ozone hole image for September 14, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

WWW Access Statistics for the ...
Totals for Summary Period: Sep 14 1996 to Sep 7 1996 ... 1.07 0.83 7047861 470 | Sep 14 1996 14.78 15.49 131763714 6506 | Sep ...

IN/UMUM: PR - kekisruhan penyelengg
IN/UMUM: PR - kekisruhan penyelengg. From: apakabar@clark.net. Date: Sat Sep 14 1996 - 08:08:00 EDT. From: John MacDougall ...

mep0996.018
... FL 2100Z SAT SEP 14 1996 TROPICAL DEPRESSION CENTER LOCATED NEAR 28.5N 106.2W AT 14/2100Z POSITION ACCURATE WITHIN ...

nep0996.018
... DEPRESSION FAUSTO DISCUSSION NUMBER 18 NATIONAL WEATHER SERVICE MIAMI FL 2 PM PDT SAT SEP 14 1996 SATELLITE AND ...

Fly me - The Irish Times - Sat, Sep ...
BEST art exhibition of the week was in the coolly trendy Front Lounge in Temple Bar. Given that it was a week where ...

Amanda Dalton, Sep 14, 1996 - Births ...
Sandy and Paul Dalton. of Spokane, Wash announce the birth of: Amanda Jean Dalton. Born: Sep 14, 1996. Weight: 7 lb. 5 oz. ...

CCN Dialup Usage for Week Ending Sep ...
... 40 ++ * * ++ |30 ++ * ++ 20 ++ * * ++ +10 ++-*0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Sermon Sep 15 1996
A Sermon by Ken Shillito - Winchelsea Sep 15 1996. Preaching Resources. Home. Winchelsea Church. Send me an email ...

M31
Andromeda galaxy M31. Image taken Sep. 15,1996, exposure 20s.

ZetaTalk: Ocean Vortex
... this Page to a Friend. ZetaTalk: Ocean Vortex. Note: written on Sep 15, 1996. Planet X and the 12th Planet are one and the same. ...

Ozone Hole Image for September 14, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 14, 1996 <Sep. 13, 1996 · Sep. 15, 1996> ...

Ozone Hole Image for September 15, 1996
Daily ozone hole image for September 15, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

WWW Access Statistics for the ...
... 15.18 16.54 151725154 7112 | Sep 16 1996 6.53 5.80 53186406 3060 | Sep 15 1996 9.43 9.58 87866340 4420 | Sep 14 1996 ...

FYI France ejournal Sep 15, 1996
3.00 FYI France: Enewsletter and archive. by Jack Kessler, kessler@well.sf.ca.us. Sep 15, 1996 issue. This file ...

TWU - TWU Libraries - 1996 TWU Update
Sep 9-Sep 15, 1996. Sep 2 - Sep 8, 1996. Aug 26-Sep 1, 1996. Aug 19-Aug 25, 1996. Aug 5-Aug 18, 1996. Jul 22-Aug 4, 1996 ...

Hardware - Inc.com
By Sarah Schafer | Sep 15, 1996 ... By Stephen Morales | Sep 15, 1996 ... By Mark Jurkowitz | Sep 15, 1996. An overview ...

Joan Harvey > Overview - AllMovie
Sep 15, 1996. Years Active. 1910. 20. 30. 40. 50. 60. 70. 80. 90. 2000. Countries. USA. Genres. Drama. Crime. Horror. Types ...

IN/HR: KMP - UNHCR Extols Boat Peop
IN/HR: KMP - UNHCR Extols Boat Peop. From: apakabar@clark.net. Date: Sun Sep 15 1996 - 16:24:00 EDT. From: John MacDougall ...

IN/EKON: PMB - Peter Gontha Masuk '
IN/EKON: PMB - Peter Gontha Masuk ' From: apakabar@clark.net. Date: Sun Sep 15 1996 - 07:53:00 EDT. From: John MacDougall ...

September 15, 1996 Chicago White Sox ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Sep 15, 1996, White Sox at Red Sox Box Score and Play by Play ...

RoB's CyBerPagE, Home
Page has had 5670 visitors since last update Sep 15, 1996. Copyright © 1996 by RobDesign, Inc. All rights NOT really reserved. ...

Wayne Fontes Lions - Photo - LIFE
Photo: Doug Pensinger/Getty Images. Sep 15, 1996. Advertisement. The Week's Best Photos: 7.30.10. Stan Musial: The Man ...

Letters, Sep. 16, 1996 - TIME
SUPER MAN ... Letters, Sep. 16, 1996. Monday, Sep. 16, 1996 ... "Christopher Reeve has proved that courage and determination ...

Notebook: Sep. 16, 1996 - TIME
... HOROWITZ; LINA LOFARO; BELINDA LUSCOMBE; JEFFERY C. RUBIN; ALAIN L. SANDERS; SIDNEY URQUHART Monday, Sep. 16, 1996 ...

News Releases - Government of ...
Sep. 16, 1996 - HARVEST ALMOST HALF COMPLETED. Sep. 16, 1996 - REFORM TO ... Sep. 16, 1996 - FUNDING FOR EARLY INTERVENTION PRESCHOOLS ...

Saturn Sep. 16,1996
Saturn, Image taken Sep. 16,1996, 02:09 am, ... Saturn, Image taken Sep. 16,1996, 02:09 am, eyepiece 12,5mm, exposure 0.001s ...

tc-list : Message: Tov's text criticism
Mon Sep 16, 1996 4:42 pm ... Sep 16, 1996. 8:48 pm ... Sep 16, 1996. 9:55 pm. Latin Psalter. Dear TC List: Can someone ...

Ohio Edison buys Centerior - Sep. 16 ...
The deal creates a holding company named FirstEnergy Corp, which will have an equity value of $4.8 billion based ...

tc-list : Message: response to ...
Mon Sep 16, 1996 4:23 pm ... Sep 16, 1996. 8:48 pm ... Sep 16, 1996. 9:55 pm. Latin Psalter. Dear TC List: Can someone ...

Key Arena - Sep 16, 1996 | Pearl Jam ...
Home › Tour › All Setlists " Key Arena - Sep 16, 1996 ... Sep 16, 1996. Set 1. Long Road. Hail, Hail ...

Dow flirts with 5,900 - Sep. 16, 1996
NEW YORK (CNNfn) - With ever-increasing confidence that the economy and interest rates will hold steady, stocks ...

Poster
Endangered Missing. ASHLEY JONES. DOB: Apr 20, 1992. Missing: Sep 16, 1996. Age Now: 18. Sex: Female. Race: White. Hair: Blonde ...

World-Wide Web Access Statistics for ...
Totals for Summary Period: Sep 16 1996 to Sep 9 1996 ... Date - -1.93 1.78 7323655 932 | Sep 16 1996 9.77 9.86 40670192 4709 ...

M32
... companion M32. Image taken Sep. 16,1996, exposure 15s. ... Andromeda companion M32. Image taken Sep. 16,1996, exposure 15s. ...

IN/HR: VOA - Mega to Sue General El
IN/HR: VOA - Mega to Sue General El. From: apakabar@clark.net. Date: Mon Sep 16 1996 - 18:36:00 EDT. From: John MacDougall ...

The official Dilbert website with ...
Sep 16, 1996. 20 Votes. 2 Comments. 4.3. Sep 21, 1996. 36 Votes. 5 Comments. 4.3. Jul 5, 1996. 47 Votes. 1 Comments. 4.31. Aug ...

Ozone Hole Image for September 15, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 15, 1996 <Sep. 14, 1996 · Sep. 16, 1996> ...

Column - Sep. 17, 1996 (a)
Sep. 3, 1996. Sep. 17, 1996 (b) Column Index - Sep. 17, 1996 ... a) Being present at the site of action -Dedicated to the ...

Art Information - Sep. 17, 1996
Aug. 27, 1996. Sep. 24, 1996. Art Infomation Index - Sep. 17, 1996. Urgent Issue of Studio Shokudo. Makoto MURATA ...

HMOs in merger talks - Sep. 17, 1996
in what could create a combined health-maintenance organization with revenues topping $6 billion, a published report said Tuesday. ...

tc-list : Message: Latin Psalter
Sep 17, 1996. 2:36 am. E-Mail Virus Alert ... Sep 17, 1996. 9:29 pm ... Sep 17, 1996. 10:42 pm. Re: response to Sollamo ...

Michael Moore takes on downsizing ...
NEW YORK (CNNfn) - Michael Moore is a gifted satirist with a populist's love for the American worker. His movie ...

Rail-Fax - Sep 17, 1996 | Canadian ...
Your browser does not support embedded PDF files.

Art Watch - Sep. 17, 1996
Sep. 10, 1996. Sep. 24, 1996. Art Watch Index - Sep. 17, 1996 <<Metamorphosis of Narcissus>> - Kim Itoh + The Glorious Future ...

Ozone Hole Image for September 17, 1996
Daily ozone hole image for September 17, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

Cool UNIX Stuff II
Cool UNIX Stuff II- Sep 17, 1996. Keith Garner (k-garner@uiuc.edu) Joe Gross (jgross@uiuc.edu) Mark Roth (roth@uiuc.edu) ...

tc-list : Message: Re: E-Mail Virus ...
Tue Sep 17, 1996 6:41 pm. Show Message Option ... Sep 17, 1996. 9:29 pm ... Sep 17, 1996. 10:42 pm. Re: response ...

IN/ECON: Double Taxation Protocol
IN/ECON: Double Taxation Protocol. From: apakabar@clark.net. Date: Tue Sep 17 1996 - 17:12:00 EDT. From: John MacDougall ...

IN/UMUM: SBYP - Kemiskinan Struktur
IN/UMUM: SBYP - Kemiskinan Struktur. From: apakabar@clark.net. Date: Tue Sep 17 1996 - 07:22:00 EDT. From: John MacDougall ...

Ackanomic Party Chess Movement Log ...
Sep 17 1996 21:12 GMT. P R c1. 1.7 Snowgod (None Yet) Sep 21 1996 01:08 GMT. P J c4. 1.8 Niccolo. Vulcan. Sep 24 1996 10:45 GMT ...

Ozone Hole Image for September 18, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 18, 1996 <Sep. 17, 1996 · Sep. 19, 1996> ...

Gene Wars for PC - GAMESPOT.com
It is almost impossible to judge the game itself ... Posted Sep 17, 1996 12:00 am PT ... Sep 17, 1996. Gene Wars Quick Links ...

News Releases - Government of ...
Sep. 18, 1996 - CIBC TELEPHONE BANKING CENTRE OFFICIALLY OPENS. Sep. 16, 1996 - HARVEST ALMOST HALF COMPLETED. Sep. ...

To Our Readers, Sep. 18, 1996 - TIME
We human beings have sought to heal ourselves for as long as we have ... By THE EDITORS Wednesday, Sep. 18, 1996. Print ...

Habitat for Humanity Int'l
Nov. 19, 1996. Habitat Expands into 50th Nation: Romania. Sep. 18, 1996. Building On Faith 1996. Sep. 9, 1996. Millard ...

GovTrack: House Vote #452 (Sep 28, 1996)
A vote in the U.S. Congress. ... House Vote #452 (Sep 28, 1996) Suspend the rules and pass: H R 3163 State Authority Tax ...

Ozone Hole Image for September 18, 1996
Daily ozone hole image for September 18, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

Grasshoppers - Servette (Sep 18, 1996)
Grasshoppers - Servette (Sep 18, 1996) After last week's Champion's League extravaganza, it was back to harsh championship ...

Resources: Books & Dissertations (r)
Date: Wed Sep 18 1996 - 07:45:00 EDT. From: John ... Written 6:24 PM Sep 18, 1996 by peg:acfoahr in igc:reg.westpapua ...

Reunification going slow - Sep. 18, 1996
LONDON (CNNfn) - Tensions were heightened this week on the Korean Peninsula after 11 suspected North Korean infiltrators ...

Ozone Hole Image for September 17, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 17, 1996 <Sep. 16, 1996 · Sep. 18, 1996> ...

Family Photos
Photos of the Grandkids! Cassidy (Birthday - Sep 18, 1996) Ryan & Jessica (Birthday - Dec 25, 1998) Emily (Birthday - May 10, 2001) ...

Does U.S. need oil reserve? - Sep ...
At the same time, Islamic fundamentalists have allegedly caused unrest in Egypt and Algeria, while there is civil unrest in ...

Clemens strikes out 20, again ...
On this day in 1996, Boston Red Sox pitcher Roger Clemens strikes out 20 ... Sep 18, 1996: Clemens strikes out 20, again ...

Notes 10
Physics 3220 - Notes, lecture 10 (Wed, Sep 18, 1996) (Previous lecture) Mathematics of Dirac delta functions. Solution ...

tc-list : Message: Re: Combined Heb ...
Sep 18, 1996. 7:06 am. Re: ... Sep 18, 1996. 9:39 am. Re: Gen 49:10 ... Sep 18, 1996. 10:52 am. Re: E-Mail Virus Alert ...

outlookindia.com - Contents ...
Contents | MAGAZINE | Sep 18, 1996 ... Sep 18, 1996. Regulars. London Diary ... The page 3 people, the chatterati and those ...

Letters, Sep. 9, 1996 - TIME
Has anyone considered that the "life on Mars" discovery may be a carefully rendered hoax, not unlike the cold-fusion ...

News Releases - Government of ...
Sep. 19, 1996 - NATIVE PRAIRIE STEWARDSHIP PROGRAM ANNOUNCED. Sep. 19, 1996 - SASK SPORT TO ... Sep. 19, 1996 - GOVERNMENT ...

Letters, Sep. 2, 1996 - TIME
OLYMPIC GOLD ... I could have faith in the possibilities of skill, discipline and attitude. ...

Anton Kern Gallery
Angus Fairhurst One Night Performance. Sep 19, 1996. Images. 1 / 10. Courtesy Anton Kern Gallery, NY ...

Sep. 19, 1996-Vol28n04: Greiner to ...
He will review the current situation at UB and SUNY, as well as look at the future and the steps that must be taken. ...

Housing starts weaken Dow - Sep. 19 ...
NEW YORK (CNNfn) - Stocks ended mixed Thursday, struggling against a weak bond market where interest rates rose ...

Sep. 19, 1996-Vol28n04: Front Page
FALL FEST '96. Better Than Ezra headlines. Suicide outranks homicide in risk to police officers, UB study shows ...

Starship Design Project Newsletters ...
Here L.I.T. crashed and the newsletter system went inactive. If we can recover the intermediate info we will add it. ...

E$O DIRTY 30$ block R.i.P.2pac.sep ...
You need to have JavaScript enabled to use all of MySpace's features. Click here for help enabling it. E$O DIRTY ...

ALS Storage Ring Beam History
Sep 19 1996. Sep 20 1996. Sep 21 1996. Sep 22 1996. Sep 23 1996. Sep 24 1996. Sep 25 1996. Sep 26 1996. Sep 27 1996. Sep 28 ...

Bentley College vs UMass-Lowell (Sep ...
Scoring Summary (Final) 1996 Bentley College Football Bentley College vs UMass-Lowell (Sep 14, 1996 at Lowell, Mass. ...

KR2S Construction Page
1995 KR Gathering. revised Sep 19, 1996. These are some pictures taken at the KR Gathering '95, held at Maury County Airport in TN. ...

Picasa Web Albums - nathalie
43 albums ... Some features may not work too well, but you are welcome to have a look around. Explore. nathalie's Gallery ...

U. of Chicago vs DePauw (Sep 14, 1996)
Kickoff time: 1:30 pm • End of Game: 4:15 • Total elapsed time: 2:45. Referee: Wallpe • Umpire: Brooks • Linesman: ...

TV's Most Fascinating People : Sep ...
Browse 35 years of PEOPLE magazine covers and articles on the Web! Read past issues and click through every PEOPLE magazine cover!

News Releases - Government of ...
Sep. 20, 1996 - FIRST NATIONS CALL CENTRE. Sep. 20, 1996 - SOCO INVESTS ... Sep. 20, 1996 - SCN COMPLETES NEW DIGITAL BROADCAST SYSTEMS ...

Stocks under witch's spell - Sep. 20 ...
NEW YORK (CNNfn) -- Wall Street stocks traded in a tight range Friday, turning higher at midday as traders awaited ...

Merrimack College vs Bentley College ...
Scoring Summary (Final) 1996 Bentley College Football Merrimack College vs Bentley College (Sep 20, 1996 ...

Hughes to buy PanAmSat - Sep. 20, 1996
Hughes will merge PanAmSat with its domestic satellite business and create a publicly traded company. The combined ...

plyr_12.htm
... Ast Total TFL-Yds No-Yds FF FR-Yds Int-Yds QBH Brk Kick Att-Mad Run Rcv Saf Pts Sep 20, 1996 MERRIMACK COLLEGE. ...

Stanford Theatre Schedule for Friday ...
Publication Date: Friday Sep 20, 1996. Stanford Theatre Schedule <*C>Playing through Sunday: Monkey Business (1931) ...

What's New
What's New. Sep. 20, 1996. English page avarable. Aug. 22, 1996. Homepage avarable(Japanese page only) Please send ...

tc-list : Messages : 1014-1043 of 8488
Sep 20, 1996. 1:26 am. 1015 ... Sep 20, 1996. 1:52 am. 1016. Re: Gen 49:10 ... Sep 20, 1996. 10:14 pm. 1017 ...

Ozone Hole Image for September 20, 1996
Daily ozone hole image for September 20, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

Zeriana Singh, Sep 20, 1996 - Births ...
Lacrecia and Elvis Singh. of Spokane, Wash announce the birth of: Zeriana Ophelia Singh. Born: Sep 20, 1996. Weight: 6 lb. 7 oz. ...

Ozone Hole Image for September 19, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 19, 1996 <Sep. 18, 1996 · Sep. 20, 1996> ...

Openhouse listing for Friday Sep 20 ...
Publication Date: Friday Sep 20, 1996. Open House Listings. You can scroll through this list of openhouses or click on one of ...

[ ] q
... Jan 14 1998 hermans.html -rw-rw-r-- 1 phyweb 947 Mar 03 1998 hermans.splash.html -rwxrwxr-x 1 phyweb 1899 Sep 20 1996 ...

Home page of Jun Yoshinobu
Last update on Sep. 20, 1996. The Institute of Physical and Chemical Research. Surface Chemistry Laboratory. 2-1Hirosawa, ...

tc-list : Message: Tov's text criticism
Sep 20, 1996. 1:26 am. Re: E-Mail Virus Alert ... Sep 20, 1996. 1:52 am. Re: Gen 49:10 ... Sep 20, 1996. 10:14 pm. Re: ...

Hulu - Pac-10 Football: From the ...
... at Arizona St.: Sep 21, 1996 ... at Arizona St.: Sep 21, 1996 Full Game (1:29:13) ... at Arizona St.: Sep 21, 1996. 1:29:13 ...

WWW Access Statistics for the ...
Totals for Summary Period: Sep 21 1996 to Sep 14 1996 ... 1.19 1.22 11169589 557 | Sep 21 1996 16.94 17.14 157292978 7939 ...

Hope College vs DePauw University
... University (Sep 21, 1996 at Greencastle, ... DePauw University Football Hope College vs DePauw University (Sep 21, 1996 ...

Ozone Hole Image for September 20, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 20, 1996 <Sep. 19, 1996 · Sep. 21, 1996> ...

Maple Leaf Gardens - Sep 21, 1996 ...
Home › Tour › All Setlists " Maple Leaf Gardens - Sep 21, 1996 ... Sep 21, 1996. Set 1. Release. Hail, Hail. Last Exit ...

LSU vs Auburn (Sep 21, 1996)
... (3-1,1-1) Date: Sep 21, 1996 Site: Auburn, Ala. ... 21 LSU vs #13 Auburn (Sep 21, 1996 at Auburn, Ala.) SACKS (UA-A): LSU ...

Nebraska at Arizona St.: Sep 21 ...
On September 21, 1996, two-time defending national champion Nebraska Cornhuskers came into ... Sep 21, 1996 ... St.: Sep 21, 1996 ...

Lehman, Sep 21, 1996 - Births ...
... Jacob Lehman. of Deer Park, Wash announce the birth of: Lehman. Born: Sep 21, 1996. Weight: 7 lb. 1 oz. Length: 20 1/2 inches ...

DePauw University - Game-by-Game ...
Sep 21, 1996. HOPE COLLEGE. W. 35-7. 2-0-0. 0-0-0 ... Stigall vs Hope College (Sep 21, 1996) ... Hope College (Sep 21, 1996) ...

Mason Barr, Sep 21, 1996 - Births ...
Carolyn and Curtis Barr. of Cheney, Wash announce the birth of: Mason Xavier Barr. Born: Sep 21, 1996. Weight: 6 lb. 1 oz. ...

Pac-10 Football: From the Archives ...
... Nebraska at Arizona St.: Sep 21, 1996 ... Air Date:Sep 21, 1996. Runtime: 1:29:13 ...

Notre Dame vs Texas Longhorns (Sep ...
Scoring Summary (Final) 1996 University of Texas Football #9 Notre Dame vs #6 Texas Longhorns (Sep 21, 1996 ...

Gator Football History - GatorZone.com
4 vs SW Louisiana (Aug 31, 1996) at Tennessee Volunteers (Sep 21, 1996) ... 46 Team, at Tennessee Volunteers (Sep 21, 1996) Punts. ...

IN: KdP - Pram Refuses AG's Summons
IN: KdP - Pram Refuses AG's Summons. From: apakabar@clark.net. Date: Sat Sep 21 1996 - 15:30:00 EDT. From: John MacDougall ...

The official Dilbert website with ...
Sep 21, 1996. 36 Votes. 5 Comments. 4.3. Jul 5, 1996. 47 Votes. 1 Comments. 4.31. Aug 9, 2009. 359 Votes. 7 Comments. 1 ...

TWU - TWU Libraries - 1996 TWU Update
Sep 16-Sep 22, 1996. Sep 9-Sep 15, 1996. Sep 2 - Sep 8, 1996. Aug 26-Sep 1, 1996. Aug 19-Aug 25, 1996. Aug 5-Aug 18, 1996 ...

Savage Hall - Sep 22, 1996 | Pearl ...
Home › Tour › All Setlists " Savage Hall - Sep 22, 1996 ... Sep 22, 1996. Set 1. Sometimes. Hail, Hail. Animal ...

Ozone Hole Image for September 22, 1996
Daily ozone hole image for September 22, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

CFJ ARCHIVE (296-310)
Judge: Techno (selected Sep 22, 1996, 10:17h EDT) ... Judge: breadbox (selected Sep 22, 1996, 17:18h EDT) ...

Sermon Sep 22 1996
A Sermon by Ken Shillito - Winchelsea Sep 22 1996. Preaching Resources. Home. Winchelsea Church. Send me an email ...

IN/EKON: KMP - Gubernur BI: RI Belu
IN/EKON: KMP - Gubernur BI: RI Belu. From: apakabar@clark.net. Date: Sun Sep 22 1996 - 07:09:00 EDT. From: John MacDougall ...

Math Forum Discussions - User ...
Sep 22, 1996 4:11 AM. 2. Re: When does 1 ... Sep 22, 1996 4:02 AM. 6. Re: Math is ... Sep 22, 1996 3:55 AM. 7. Re: Que: ...

Broncos V Chiefs - Photo - LIFE
... won the game 17-14. Mandatory Credit: Stephen Dunn /Allspor. Photo: Stephen Dunn/Getty Images. Sep 22, 1996. Advertisement ...

IN/HUKUM: KMP - Tindak Lanjut Temua
IN/HUKUM: KMP - Tindak Lanjut Temua. From: apakabar@clark.net. Date: Sun Sep 22 1996 - 06:55:00 EDT. From: John MacDougall ...

CCN Dialup Usage for Week Ending Sep ...
... 40 ++ * * ++ |30 ++ *** * ++20 ++ * * ++ +10 ++-*0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Sherbrooke Beavers at Gatineau ...
... Sep 22, 1996 ... Sherbrooke Beavers at Gatineau Olympiques. Sep 22, 1996. Olympiques win 3-1. Fights. Time. Away ...

draft-pouffary-itot-03 - ISO ...
... on top of TCP Sep 22, 1996 Y. Pouffary, ... Transport Service on top of TCP Sep 22, 1996 Y. Pouffary, A. Young 4.2 Class 2 ...

September 22, 1996 Montreal Expos at ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Sep 22, 1996, Expos at Braves Box Score and Play by Play ...

Anoeta Velodrome - Nov 22, 1996 ...
Sep 22, 1996 - Toledo. Sep 21, 1996 - Toronto. Sep 16, 1996 - Seattle. Sep 14, 1996 - Seattle. 1995 Setlists. 1994 Setlists ...

Dante Washington Burn - Photo - LIFE
Photo: Jamie Squire/Getty Images. Sep 22, 1996. Advertisement. Stan Musial: The Man. Synchronized Swimmers Go Wild ...

Notebook: Sep. 23, 1996 - TIME
... M. SIMONS AND SIDNEY URQUHART Monday, Sep. 23, 1996 ... Petersburg, Florida, including samples of the top sellers over ...

Milestones Sep. 23, 1996 - TIME
Milestones Sep. 23, 1996. Monday, Sep. 23, 1996 ... RONALD PERELMAN, 53, acquisitive Revlon cosmetics billionaire, and ...

News Releases - Government of ...
Sep. 23, 1996 - GRAVELBOURG WATER SYSTEM TO BE BUILT. Sep. 20, 1996 - CUSTOM COMBINE OPERATORS AVAILABLE THROUGH LISTING SERVICE ...

Starting Over : Sep 23, 1996 ...
... years, 1,915 covers and 49,833 stories from PEOPLE magazine's history for you to enjoy. Sep 23, 1996 Vol. 46 No. 13 ...

L.A. debates 'living wage' - Sep. 23 ...
Lancaster Uniform Cap, which manufactures embroidered caps for the Los Angeles Police Department, is one of dozens ...

Russia bears on Wall St. - Sep. 23, 1996
Investors in Russia were relieved when President Boris Yeltsin survived the mid-summer election. But anxiety has returned ...

The New Yorker Digital Edition : Sep ...
The New Yorker : Sep 23, 1996. Contents. Comment. Cartoon. The Talk of the Town. The Talk of the Town. Television. The Talk of ...

Ozone Hole Image for September 23, 1996
Daily ozone hole image for September 23, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

Starship Design Project Newsletters ...
Week 118 - Sep. 23, 1996. Week 117 - Sep. 16, 1996. Week 116 - Sep. 9, 1996. Week 115 - Sep. 2, 1996. Week 114 - Aug. 26, 1996 ...

AllPolitics - TIME This Week: Sep ...
Parochial Politics. Catholic schools do a good job. But should they siphon money from public education? That is the real "choice" ...

Fall guys - The Irish Times - Mon ...
IF IT IS a truism that men's fashion registers little change from one season to the next, how much more is this the case for ...

September 23, 1996 Milwaukee Brewers ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Sep 23, 1996, Brewers at Orioles Box Score and Play by Play ...

Ozone Hole Image for September 22, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 22, 1996 <Sep. 21, 1996 · Sep. 23, 1996> ...

Theatre of Dreams FTP Application
21189 Sep 23 1996 anfire.gif ... 1388 Sep 23 1996 annote.gif ... 399 Sep 23 1996 fadeline.gif. 33735 Apr 16 12:39 ...

CHECK UP - The Irish Times - Mon ...
THE Dublin Rape Crisis Centre needs volunteers to train as telephone counsellors to staff their 24 hour lines outside office ...

Art Watch - Sep. 24, 1996
Sep. 17, 1996. Oct. 1, 1996. Art Watch Index - Sep. 24, 1996. Where Is the <<IZUMIWAKU>> Going? Makoto MURATA. The ...

News Releases - Government of ...
Sep. 24, 1996 - JUSTICE MINISTER REQUESTS AN INVESTIGATION INTO JUDGE'S CONDUCT. Sep. 23, 1996 - GRAVELBOURG WATER ...

Art Information - Sep. 24, 1996
Sep. 17, 1996. Oct. 1, 1996. Art Infomation Index - Sep. 24, 1996. R96 Rotterdam Festivals-the New Temptation. Yukiko SHIKATA ...

brinkmad by author
Archived on: Tue Sep 24 1996 - 17:03:49 PDT. Messages sorted by: [ date ][ thread ][ subject ] Other mail archives ...

Clinton welcomes Fed move - Sep. 24 ...
WASHINGTON (CNNfn) - President Clinton received a campaign gift Tuesday when the Federal Reserve decided not to ...

Merriweather Post Pavilion - Sep 24 ...
Home › Tour › All Setlists " Merriweather Post Pavilion - Sep 24, 1996 ... Sep 24, 1996. Set 1. Long Road. Hail, Hail. Animal ...

Stocks unmoved by Fed - Sep. 24, 1996
NEW YORK (CNNfn) - Stocks stayed close to even Tuesday as Wall Street digested the Federal Reserve's decision to ...

Garran - The Irish Times - Tue, Sep ...
ARRAN, the latest project sponsored under the Arts Council Interdsciplinary Arts scheme, drew a large crowd to the Botanic Gardens ...

Hunter Hunted for PC - GAMESPOT.com
Hunter Hunted is a level-hopping step in the ... Posted Sep 24, 1996 12:00 am PT ... Sep 24, 1996. Hunter Hunted Quick Links ...

Picasa Web Albums - PANTXO
Sep 24, 1996. Photos: 29. setas G. Sep 23, 1996. Photos: 153. setas H. Aug 24, 1996. Photos: 44. setas I. Jul 24, 1996. Photos: ...

Ozone Hole Image for September 23, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 23, 1996 <Sep. 22, 1996 · Sep. 24, 1996> ...

Carson rumour - The Irish Times ...
RUMOURS that Willie Carson will vacate his position as first jockey to Hamdan Al Maktoum on his return from injury were yesterday ...

Archive - Sep 24, 1996 | UK Fundraising
Archive - Sep 24, 1996. Recent News. Date. All. 1970. 1993. 1994. 1995. 1996. 1997. 1998. 1999. 2000. 2001. 2002. 2003. 2004 ...

SEP 24, 1996 In Reply Refer To: FWS ...
SEP 24, 1996. In Reply Refer To: FWS/AES/TE. Memorandum. To: Acting Director, Office of Surface Mining Reclamation and Enforcement ...

IN/POL: JWP - Daftar Caleg PDI Dike
IN/POL: JWP - Daftar Caleg PDI Dike. From: apakabar@access.digex.net. Date: Tue Sep 24 1996 - 07:39:00 EDT. From: ...

Stocks wander aimlessly - Sep. 25, 1996
NEW YORK (CNNfn) - Wall Street continued to struggle Wednesday with the Federal Reserve's decision to hold the line ...

News Releases - Government of ...
Sep. 25, 1996 - 1996 HARVEST OVER 50 PER CENT COMPLETE. Sep. 24, 1996 - JUSTICE MINISTER REQUESTS AN INVESTIGATION ...

Sep 25,1996 Cliff Stoll A Skeptical ...
Sep 25,1996 Cliff Stoll A Skeptical View of Computing ... Previous: Stanford University Computer. Sep 25,1996. Cliff Stoll ...

Funeral co. to kill merger - Sep. 25 ...
NEW YORK (CNNfn) -- Funeral home and cemetery company Loewen Group Inc. on Wednesday said it has rejected a $2.8 ...

Ozone Hole Image for September 25, 1996
Daily ozone hole image for September 25, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

[2005] Title 825 Indiana Grain ...
Sep 25, 1996, 10:00 a.m.: 20 IR 322; readopted ... ( Indiana Grain Indemnity Corporation; 825 IAC 1-3-2; filed Sep 25, 1996, ...

Resources: Online & Disk Media (r)
Resources: Online & Disk Media (r) From: apakabar@access.digex.net. Date: Wed Sep 25 1996 - 16:27:00 EDT. From: John ...

G:\IAC\IRCYCLE_XML\Manuscpt ...
filed Sep 25, 1996, 10:00 a.m.: 20 IR 322; readopted filed Dec 2, 2002, 2:52 p.m. ... 825 IAC 1-3-2; filed Sep 25, 1996, ...

KDUS.OB: Historical Prices for CADUS ...
Sep 25, 1996. 5.75. 5.75. 5.75. 5.75. 400. 5.75. Sep 24, 1996. 5.75. 5.75. 5.75. 5.75. 1,000. 5.75. Sep 23, 1996. 6.25. 6.50 ...

IN/ET: Oan Kiak Literary Awards
IN/ET: Oan Kiak Literary Awards. From: apakabar@access.digex.net. Date: Wed Sep 25 1996 - 18:25:00 EDT. From: John ...

outlookindia.com - Contents ...
Contents | MAGAZINE | Sep 25, 1996 ... Sep 25, 1996. Regulars. Shimla Diary ... The page 3 people, the chatterati and those ...

Notes 13
Physics 3220 - Notes, lecture 13 (Wed, Sep 25, 1996) (Previous lecture) More expansion postulate: how to expand ...

tc-list : Message: Tov's text criticism
Sep 25, 1996. 2:01 am ... Sep 25, 1996. 6:36 am ... Sep 25, 1996. 9:31 am. Re: Teaching Textual Criticism. As TC book ...

Click to see the message monospaced ...
Date: Sep 25, 1996 1:09 PM Author: r.cammer ... On Sep 25, 1996 10:11:52 in article <Re: TWA 800 meteor hit calculation ? ...

FRB: H.4.1 Release-- Factors ...
... since * Wednesday Wednesday Wednesday Sep 25, 1996 Sep 18, 1996 Sep 27, 1995 -ASSETS Gold certificate account 11, ...

GovTrack: House Vote #441 (Sep 26, 1996)
A vote ... Suspend the rules and agree, as amended: H CON RES 189 U.S. Membership in South ... Sep 26, 1996 6:48PM. Result: ...

News Releases - Government of ...
Sep. 26, 1996 - PROVINCE REMOVES HEALTH AND SOCIAL ASSISTANCE LEVIES. Sep. ... Sep. 26, 1996 - UNIVERSITY REPORT AND RESPONSE RELEASED ...

GovTrack: House Vote #444 (Sep 26, 1996)
Suspend the rules and pass, as amended: H R 3841 Civil Service Reform Act ... Sep 26, 1996 7:19PM. Result: Failed. Related Bill: ...

ValuJet cleared to fly - Sep. 26, 1996
NEW YORK (CNNfn) - After about a three-month flight suspension, ValuJet Airlines will soon take to the skies again. ...

Chicago Reader | Issue Archives ...
Comprehensive guide to Chicago ... Google the site Search our articles archive Search for an event " Previous Issue. Next ...

1996 | News Releases | News & Media ...
Pharmaceutical: Introduction of Alnert (R) Dry Syrup,A cerebrovascular type psychiatric symptom improving agent. Sep. 26, 1996 ...

Ozone Hole Image for September 26, 1996
Daily ozone hole image for September 26, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

Digest 1 of pSEAP2-Control: 5115 ...
Thu, Sep 26, 1996. Page. Asp718 I. KpnI. Ecl136 II ... Thu, Sep 26, 1996. Page. BsmI ... Thu, Sep 26, 1996. Page ...

Civic Center - Sep 26, 1996 | Pearl ...
Home › Tour › All Setlists " Civic Center - Sep 26, 1996 ... Sep 26, 1996. Set 1. Sometimes. Hail, Hail. Animal ...

BoC Playlist: 1996.09.26
Breakfast of Champions Playlist: 1996.09.26. WMBR 88.1 FM Cambridge, Massachusetts (MIT community radio) Thursday ...

1996 | News Releases | News & Media ...
Sep 26, 1996. News Releases. Archives. Downloads. News Releases 1996. September 26, 1996. Mitsubishi Chemical Kojin ...

Sep. 26, 1996-Vol28n05: Bulls ...
The UB Bulls/Cornell University football game will take place at noon Saturday, Oct. 5. Time of the football game, ...

Olson, Sep 26, 1996 - Births ...
Jennifer and Darrin Olson. of Colville, Wash announce the birth of: Olson. Born: Sep 26, 1996. Weight: 0 lb. Length: 0 inches ...

Ozone Hole Image for September 25, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 25, 1996 <Sep. 24, 1996 · Sep. 26, 1996> ...

Sep. 26, 1996-Vol28n05: Good Morning ...
... vice president for student affairs and dean of students, front and center, leading the participants in the Student Union. ...

News Releases - Government of ...
Sep. 27, 1996 - CHILDREN TO BENEFIT FROM 1996 SGI CANADA CHARITY CLASSIC. Sep. 27, 1996 - CHILD ... Sep. 27, 1996 - HUMAN RIGHTS ...

Airfares lose altitude - Sep. 27, 1996
NEW YORK (CNNfn) - Airline passengers are finding lower prices with the return of two airlines. Pan Am is flying ...

Openhouse listing for Friday Sep 27 ...
Publication Date: Friday Sep 27, 1996. Open House Listings. You can scroll through this list of openhouses or click on one of ...

nancies.org: tour: reviews: sep.27.1996
All trademarks and copyrights owned by their respective owners. User-submitted comments are owned by the individual that ...

Ozone Hole Image for September 27, 1996
Daily ozone hole image for September 27, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

Stanford Theatre Schedule for Friday ...
Publication Date: Friday Sep 27, 1996. Stanford Theatre Schedule <*C>Playing through Sunday: Duck Soup (1933) Considered ...

U.S. GDP up 4.7 percent - Sep. 27, 1996
Economy growing at fastest rate in two years, Commerce Department says. NEW YORK (CNNfn) -- The U.S. economy expanded ...

1996-09-27 @ Tramps | The Official ...
... Flash for the full site experience. UPCOMING EVENTS. TOUR ARCHIVE. Sep 27, 1996. Tramps. New York City, NY, United States ...

IN/POL: KMP - Pemerintah Segel Kant
IN/POL: KMP - Pemerintah Segel Kant. From: apakabar@access.digex.net. Date: Fri Sep 27 1996 - 16:10:00 EDT. From: ...

Magazine Archive | More ...
Sep 27, 1996 Issue #346. View Contents. Sep 20, 1996 Issue #345. View Contents. Sep 06, 1996 Issue #343. View Contents. Year: 1996 ...

News - Articles - 1425660 - 19960927
Sep 27 1996 12:00 AM EDT. New Edition: Don't Call It A Comeback. Views93. Sept. 27, 1996 -- The 80's hit machine ...

Ozone Hole Image for September 26, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 26, 1996 <Sep. 25, 1996 · Sep. 27, 1996> ...

PEOPLE - The Irish Times - Fri, Sep ...
BOB Geldof went to the High Court in London yesterday for an emergency order relating to the future of his three children after ...

Administrative Proceedings Archives ...
Sep. 27, 1996. Milton Puryear. 34-37743. Sep. 27, 1996 ... Sep. 27, 1996. Concord Investment Company. IA-1584. Sep. ...

Notes 14
Physics 3220 - Notes, lecture 14 (Fri, Sep 27, 1996) (Previous lecture) Parity, parity eigenfunctions. Start Ch. ...

GovTrack: House Vote #451 (Sep 28, 1996)
Suspend the rules and pass, as amended: H R 1332 Omnibus Insular Areas ... Sep 28, 1996 7:25PM. Result: Passed. Related Bill: ...

Sep-28-1996 - NOFX Wiki
Sep-28-1996. Gig Information. Date: Sep-28-1996. City: London, UK ... Retrieved from "http://nofxwiki.net/w/Sep-28-1996" ...

GovTrack: House Vote #452 (Sep 28, 1996)
Suspend the rules and pass: H R 3163 State Authority Tax Compensation Act ... Sep 28, 1996 7:36PM. Result: Failed. Related Bill: ...

Stony Brook vs Bentley College (Sep ...
... Football Stony Brook vs Bentley College (Sep 28, 1996 ... Bentley College (3-0) Date: Sep 28, 1996 Site: Waltham, Mass. ...

Ozone Hole Image for September 28, 1996
Daily ozone hole image for September 28, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

Bentley College - Game-by-Game ...
... 1 245 5 44 2 49 0 30 5 13 0 17 297 Sep 28, 1996 STONY BROOK. ... 1 87 0 44 8 135 0 21 2 22 0 20 166 Sep 28, 1996 STONY BROOK. ...

CFJ ARCHIVE (296-310)
2nd Judge: Robin Hood (selected Sep 28, 1996, 03:05h EDT) ... is not a name (selected Sep 28, 1996, 00:04h EDT) (declined to ...

Jungle calls - The Irish Times - Sat ...
It is as integral to their lives as adoration of the Virgin Mary, rice and beans three times a day and wearing astonishingly ...

Cracker actor - The Irish Times ...
WHEN Michael Winterbottom and Andrew Eaton, the director and producer of Roddy Doyle's Family, set about making Jude, their film ...

DePauw University vs Albion College
... Albion College (Sep 28, 1996 at Albion, ... DePauw University Football DePauw University vs Albion College (Sep 28, 1996 ...

September 28, 1996 Baltimore Orioles ...
You Are Here > Baseball-Reference.com > Box Scores > 1996 > Sep 28, 1996, Orioles at Blue Jays Box Score and Play by Play ...

Ozone Hole Image for September 27, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 27, 1996 <Sep. 26, 1996 · Sep. 28, 1996> ...

IN: Seruan Bertindak - Tiga Aktivis
IN: Seruan Bertindak - Tiga Aktivis. From: apakabar@access.digex.net. Date: Sat Sep 28 1996 - 16:46:00 EDT. From: ...

New Mexico State vs LSU (Sep 28, 1996)
Scoring Summary (Final) New Mexico State (0-5-0) vs. LSU (3-0-0,1-0) Date: Sep 28, 1996 Site: Baton Rouge, ...

IN/POL: PMB - Kantor DPP PDI Versi
IN/POL: PMB - Kantor DPP PDI Versi. From: apakabar@access.digex.net. Date: Sat Sep 28 1996 - 17:11:00 EDT. From: John ...

Poster
Endangered Missing. RILYA WILSON. DOB: Sep 29, 1996. Missing: Jan 18, 2001. Age Now: 13. Sex: Female. Race: Black. Hair: Black ...

Ozone Hole Image for September 29, 1996
Daily ozone hole image for September 29, 1996 ... Please credit all images and animations to NASA, unless otherwise noted. ...

Downing Stadium, Randall's Island ...
Home › Tour › All Setlists " Downing Stadium, Randall's Island - Sep 29, 1996 ... Sep 29, 1996. Set 1. Sometimes. Go ...

TWU - TWU Libraries - 1996 TWU Update
Sep 23-Sep 29, 1996. Sep 16-Sep 22, 1996. Sep 9-Sep 15, 1996. Sep 2 - Sep 8, 1996. Aug 26-Sep 1, 1996. Aug 19-Aug 25, 1996 ...

NBA PAGE
TEAM PLAYER. Background file is changed!!! *. BMP to *.JPG file. It will save people ... Sep 29,1996. Now on available ...

Sermon Sep 29 1996
A Sermon by Ken Shillito - Winchelsea Sep 29 1996. Preaching Resources. Home. Winchelsea Church. Send me an email ...

Ozone Hole Image for September 28, 1996
Home Historical Ozone Maps Meteorology Ozone Facts Multimedia Education. September 28, 1996 <Sep. 27, 1996 · Sep. 29, 1996> ...

Sep 29, 1996 - Sunday Mirror ...
Articles in Sep 29, 1996 issue of Sunday Mirror. Sunday edition of Britain's tabloid newspaper features articles on ...

MLB PAGE
It will save people download time. ... Sep 29,1996. Now on available. Dodgers Pics. ... Sep 29,1996. Now on available ...

Wembley Arena - Oct 29, 1996 | Pearl ...
Sep 29, 1996 - New York. Sep 28, 1996 - New York. Sep 26, 1996 - Augusta. Sep 24, 1996 - Columbia. Sep 22, 1996 - Toledo ...

CCN Dialup Usage for Week Ending Sep ...
... 40 ++ * * ++ |30 ++ * ++ 20 ++ ** ** ++10 ++-0 5 10 15 20 25 Time of Day (24-hour clock) Previous Week's Pattern ...

Organizations Registry (r)
Organizations Registry (r) From: apakabar@access.digex.net. Date: Sun Sep 29 1996 - 09:23:00 EDT. From: John MacDougall ...

Beauport Harfangs at Laval Titan Sep ...
Beauport Harfangs at Laval Titan Sep 29, 1996 ... Beauport Harfangs at Laval Titan. Sep 29, 1996. Titan win 6-4. There were ...

Portland
PORTLAND MARATHON. Sep.29, 1996. 25th Portland Marathon. Full Marathon. Fumi 3:17:59. Marafun (Mile race for Kids) ...

Phillippi Sparks - Photo - LIFE
Photo: Al Bello/Getty Images. Sep 29, 1996. Advertisement. Stan Musial: The Man. Synchronized Swimmers Go Wild. Maria ...

Notebook: Sep. 30, 1996 - TIME
... JANICE M. HOROWITZ, LINA LOFARO, JEFFERY C. RUBIN, ALAIN L. SANDERS AND SIDNEY URQUHART Monday, Sep. 30, 1996 ...

People: Sep. 30, 1996 - TIME
By Belinda Luscombe Monday, Sep. 30, 1996 ... ELLEN MORGAN, the subject of one of the ugliest and most controversial custody ...

News Releases - Government of ...
Sep. 30, 1996 - WEATHER HAS STALLED 1996 HARVEST. Sep. 30, 1996 ... Sep. 30, 1996 - SUPPORT FOR UNIVERSAL ACCESS TO TELECOMMUNICATIONS ...

PLM Group
Your browser does not support script. QUARTER. QUARTER DATE. Q3 '96. Sep 30, 1996. Q2 '96. Jun 30, 1996. Q1 '96. Mar 31, 1996 ...

Indian Ocean Report 9/96
SUMMARY REPORT _WEEKLY TEMPERATURE ANOMALY MAP (IND) SEP 02-SEP 30 1996 (246-274) ID EXP END LAT END LON S.T. E.T. ...

Rattled Royals : Sep 30, 1996 ...
... years, 1,916 covers and 49,834 stories from PEOPLE magazine's history for you to enjoy. Sep 30, 1996 Vol. 46 No. 14 ...

Formula 1 for PlayStation - Formula ...
Formula 1 for PlayStation - GameSpot offers reviews, ... Release Date: Sep 30, 1996 ... Release: Sep 30, 1996 " ESRB: Everyone ...

The New Yorker Digital Edition : Sep ...
The New Yorker : Sep 30, 1996. Contents. Comment. Cartoon. The Talk of the Town. The Talk of the Town. Cartoon. The Talk of the ...

Dow strengthens at midday - Sep. 30 ...
NEW YORK (CNNfn) -- Wall Street stocks turned cautiously higher on Monday, as investors shrugged off strong rises ...

Boston Ed in $300M deal - Sep. 30, 1996
... C-TEC said Monday they plan to invest in television, utility, and Internet services in a deal worth $300 million. ...

Administrative Proceedings Archives ...
Sep. 30, 1996 ... Sep. 30, 1996. Vigil Asset Management Group, Inc. ... Sep. 30, 1996. Fahnestock and Co., Inc. ...

Sep
... for Sep 1, 1996 - Sep 30, 1996 page: A-1 DATE A I ... min)/2 ] Veg Crops Weather Data Summary for Sep 1, 1996 - Sep 30, 1996 ...

Daily Transmission Statistics
... 403 97,206 | Sep 28 1996 3.09 2.71 833,033,110 104,144 | Sep 29 1996 4.24 3.60 1,106,874,430 143,017 | Sep 30 1996 ...

World-Wide Web Access Statistics for ...
Totals for Summary Period: Sep 30 1996 to Sep 16 1996 ... 1.30 1.30 14361091 1648 | Sep 30 1996 6.10 5.91 65456267 7717 | Sep ...

NYT: Historical Prices for New York ...
Sep 30, 1996. 31.50. 32.58. 31.50. 32.34. 205,200. 12.68. Sep 27, 1996. 31.98. 31.98. 31.26. 31.62. 392,000. 12.40. Sep 26, ...


auction - fastforward09-micro - scienceparkrome - 1smf - vegandinner - bob6 - ess7 - area from web - same name - 365 from web zh-CHS